3: Inventory management
|
|
- Mariah Mason
- 6 years ago
- Views:
Transcription
1 INSE6300 Ji Yun Yu 3: Inventory mngement Concordi Februry 9, 2016 Supply chin mngement is bout mking sequence of decisions over sequence of time steps, fter mking observtions t ech of these time steps. We illustrte this with the problem of mnging n inventory of nonperishble goods when demnd is stochstic. We first need to introduce the notion of Mrkov chins (e.g., wether model, coupon collector, etc.). Figure 1: From wether-model.png 1 Numericl exmple Consider the lst horse-drwn crrige deler in the world, which just took lese of N = 4 months on showroom. At time t = 1, 2, 3, 4, the strting inventory level is s t, the order size is t, nd the rndom demnd is d t. The rndom vribles {d t } re i.i.d. with the following distribution: 0 w.p. 0.1, d t = 1 w.p. 0.7, 2 w.p
2 Figure 2: From exportersindi.com The inventory level t the next time step t + 1 evolves ccording to the following Mrkov process: 0 if s t + t d t < 0, s t+1 = s t + t d t if 0 s t + t d t 2, (1) 2 if s t + t d t > 2. Suppose tht the ordering cost of ech unit of inventory is 1, nd tht both the holding nd bckorder costs re qudrtic, the overll cost is c(s t, t, d t ) = t + (s t + t d t ) 2. Unsold inventory hs no slvge vlue. Bckwrd induction strts t t = N = 4, nd ssigns vlue to ech inventory stte. Since unsold inventory hs no slvge vlue, we hve V 4 (0) = V 4 (1) = V 4 (2) = 0. For t = 1, 2, 3, we ssign the following vlues to the sttes: V t (s) = min E{c(s,, d t ) + V t+1 (s t+1 )} = min E{c(s,, d t ) + V t+1 ([s + d t ] 2 0)}, where we used the definition of s t+1 in (1) nd the nottion [ ] 2 0 to clmp to stte to the llowed rnge. Nmely, for t = 3, using the distribution of d t bove, we obtin V 3 (s) = min E{c(s,, d 3 ) + V 4 (s 4 )} = min E{ + (s + d t ) 2 + 0} ( = min + 0.1(s + 0) (s + 1) (s + 2) ), 2 2
3 nd The optiml order sizes re Repet for t = 2 nd t = 1: 1.3 if s = 0, V 3 (s) = 0.3 if s = 1, 1.1 if s = 2. 3(s) = 0 if s = 1, 2.5 if s = 0, V 2 (s) = 1.5 if s = 1, 1.68 if s = 2. 2(s) = 0 if s = 1, 3.7 if s = 0, V 1 (s) = 2.7 if s = 1, if s = 2. 1(s) = 0 if s = 1, Observe tht the optiml order size is 1 if the current inventory is 0, nd 0 otherwise. 2 Stochstic inventory mngement Consider single product (e.g., crs), nd discrete time steps (e.g., months 1, 2, etc.). Every time step (e.g., every month), the decision mker oberserves the current inventory level, nd decides how much inventory to order from the supplier. There re costs for holding inventory. The demnd is rndom, but we know the distribution of the rndom vrible. The gol is mximize the expected vlue of the profit (revenue minus costs) over number N of months. Assumptions: Delivery is instntneous (no led-time); The demnd tke integer vlues; 3
4 The demnd is i.i.d. with given distribution p j = P(D t = j) for j = 0, 1,...; Inventory hs cpcity M. For time steps t = 1, 2,..., let s t denote the inventory level, t the order size, nd D t the demnd t time t these re ll integer-vlued. The inventory level from one time step to the next follows this dynmics: The rewrd or profit t time t is s t+1 = mx{s t + t D t, 0}. r t (s t, t ) = F (s t + t ) O( t ) h(s t + t ), for t = 1,..., N 1, present vlue of inventory order holding r N (s N, N ) = g(s N, N ). slvge vlue where the expected present vlue of inventory is F (z) = z 1 j=0 f(j) revenue from j sles p j + j z f(z) p k, for z = 0, 1,... revenue cpped to z sles The order nd holding cost function cn be rbitrry; for instnce, O(z) = [K + c(z)]1 [z>0]. Remrk 1. Bckorder costs (missed sles) re implicitly ccounted for in the profit. 2.1 MDP We cn describe the stochstic inventory mngement problem s n MDP. The inputs re: Holding cost function h, order cost O, sles revenue f, slvge revenue g; Probbilities p 0, p 1,...; Time horizon: {1, 2,..., N}; Stte spce: S = {0, 1,..., M}; Action spce: A = {0, 1,..., M}; Expected rewrd: r 1, r 2,..., r N ; Stte trnsition probbilities: P (s s, ) = 0 if s (s +, M], p s+ s if s (0, s + ] nd s + M, k>s+ p k if s = 0 nd s + M. This is the probbility of hving n inventory level s t the next time step when the inventory level t the current time step is s nd we order units of inventory. 4
5 The output is optiml sequence of policies σ 1, σ 2,..., where σ j : S A. These policies re used to pick the optiml ction to tke t ech time step: suppose tht t time t = 1, 2,..., N, we observe the stte s t ( rndom vrible), then the optiml ction is σ t (s t ). Remrk 2 (Rewrd vs cost). We cn define the MDP in terms of costs by replcing the expected rewrd by expected cost, s in the numericl exmple bove, nd by replcing the mx by min. 2.2 Solving finite-horizon MDP by bckwrd induction How do we compute the optiml policies σ 1, σ 2,...? We propose method of dynmic progrmming clled bckwrd induction. The bckwrd induction lgorithm for MDPs proceeds s follows. 1. Set j = N, nd V N (s) = mx A r N (s, ) = g(s) for ll s S; 2. For j = N 1, N 2,..., 1: () For s S: i. Compute V j (s) = mx A { r j (s, ) + s S P (s s, )V j+1 (s) } ; ii. Output σ j (s) rg mx A { rj (s, ) + s S P (s s, )V j+1 (s) }. The output policies σ 1,..., σ N re optiml (cf. Putermn, Section 4.3). 3 References Mrkov Decision Processes, M. Putermn, Chpter 1. 5
Chapter 3: The Reinforcement Learning Problem. The Agent'Environment Interface. Getting the Degree of Abstraction Right. The Agent Learns a Policy
Chpter 3: The Reinforcement Lerning Problem The Agent'Environment Interfce Objectives of this chpter: describe the RL problem we will be studying for the reminder of the course present idelized form of
More informationDYNAMIC PROGRAMMING REINFORCEMENT LEARNING. COGS 202 : Week 7 Presentation
DYNAMIC PROGRAMMING REINFORCEMENT LEARNING COGS 202 : Week 7 Preenttion OUTLINE Recp (Stte Vlue nd Action Vlue function) Computtion in MDP Dynmic Progrmming (DP) Policy Evlution Policy Improvement Policy
More informationCS 188 Introduction to Artificial Intelligence Fall 2018 Note 4
CS 188 Introduction to Artificil Intelligence Fll 2018 Note 4 These lecture notes re hevily bsed on notes originlly written by Nikhil Shrm. Non-Deterministic Serch Picture runner, coming to the end of
More informationReinforcement Learning. CS 188: Artificial Intelligence Fall Grid World. Markov Decision Processes. What is Markov about MDPs?
CS 188: Artificil Intelligence Fll 2010 Lecture 9: MDP 9/2/2010 Reinforcement Lerning [DEMOS] Bic ide: Receive feedbck in the form of rewrd Agent utility i defined by the rewrd function Mut (lern to) ct
More information9.3. Regular Languages
9.3. REGULAR LANGUAGES 139 9.3. Regulr Lnguges 9.3.1. Properties of Regulr Lnguges. Recll tht regulr lnguge is the lnguge ssocited to regulr grmmr, i.e., grmmr G = (N, T, P, σ) in which every production
More informationA Fuzzy Inventory Model With Lot Size Dependent Carrying / Holding Cost
IOSR Journl of Mthemtics (IOSR-JM e-issn: 78-578,p-ISSN: 9-765X, Volume 7, Issue 6 (Sep. - Oct. 0, PP 06-0 www.iosrournls.org A Fuzzy Inventory Model With Lot Size Dependent Crrying / olding Cost P. Prvthi,
More informationGridworld Values V* Gridworld: Q*
CS 188: Artificil Intelligence Mrkov Deciion Procee II Intructor: Dn Klein nd Pieter Abbeel --- Univerity of Cliforni, Berkeley [Thee lide were creted by Dn Klein nd Pieter Abbeel for CS188 Intro to AI
More informationCache CPI and DFAs and NFAs. CS230 Tutorial 10
Cche CPI nd DFAs nd NFAs CS230 Tutoril 10 Multi-Level Cche: Clculting CPI When memory ccess is ttempted, wht re the possible results? ccess miss miss CPU L1 Cche L2 Cche Memory L1 cche hit L2 cche hit
More informationOutline. CS 188: Artificial Intelligence Spring Speeding Up Game Tree Search. Minimax Example. Alpha-Beta Pruning. Pruning
CS 188: Artificil Intelligence Spring 2011 Lecture 8: Gme, MDP 2/14/2010 Pieter Abbeel UC Berkeley Mny lide dpted from Dn Klein Outline Zero-um determinitic two plyer gme Minimx Evlution function for non-terminl
More informationSmart Investment Strategies
Smrt Investment Strtegies Risk-Rewrd Rewrd Strtegy Quntifying Greed How to mke good Portfolio? Entrnce-Exit Exit Strtegy: When to buy? When to sell? 2 Risk vs.. Rewrd Strtegy here is certin mount of risk
More informationCH 71 COMPLETING THE SQUARE INTRODUCTION FACTORING PERFECT SQUARE TRINOMIALS
CH 7 COMPLETING THE SQUARE INTRODUCTION I t s now time to py our dues regrding the Qudrtic Formul. Wht, you my sk, does this men? It mens tht the formul ws merely given to you once or twice in this course,
More informationChapter55. Algebraic expansion and simplification
Chpter55 Algebric expnsion nd simplifiction Contents: A The distributive lw B The product ( + b)(c + d) C Difference of two squres D Perfect squres expnsion E Further expnsion F The binomil expnsion 88
More informationAnnouncements. CS 188: Artificial Intelligence Fall Recap: MDPs. Recap: Optimal Utilities. Practice: Computing Actions. Recap: Bellman Equations
CS 188: Artificil Intelligence Fll 2009 Lecture 10: MDP 9/29/2009 Announcement P2: Due Wednedy P3: MDP nd Reinforcement Lerning i up! W2: Out lte thi week Dn Klein UC Berkeley Mny lide over the coure dpted
More informationRoadmap of This Lecture
Reltionl Model Rodmp of This Lecture Structure of Reltionl Dtbses Fundmentl Reltionl-Algebr-Opertions Additionl Reltionl-Algebr-Opertions Extended Reltionl-Algebr-Opertions Null Vlues Modifiction of the
More informationJFE Online Appendix: The QUAD Method
JFE Online Appendix: The QUAD Method Prt of the QUAD technique is the use of qudrture for numericl solution of option pricing problems. Andricopoulos et l. (00, 007 use qudrture s the only computtionl
More informationMATH 236 ELAC MATH DEPARTMENT FALL 2017 SHORT ANSWER. Write the word or phrase that best completes each statement or answers the question.
MATH 236 ELAC MATH DEPARTMENT FALL 2017 TEST 1 REVIEW SHORT ANSWER. Write the word or phrse tht best completes ech sttement or nswers the question. 1) The supply nd demnd equtions for certin product re
More informationNon-Deterministic Search. CS 188: Artificial Intelligence Markov Decision Processes. Grid World Actions. Example: Grid World
CS 188: Artificil Intelligence Mrkov Deciion Procee Non-Determinitic Serch Dn Klein, Pieter Abbeel Univerity of Cliforni, Berkeley Exmple: Grid World Grid World Action A mze-like problem The gent live
More informationMaximum Expected Utility. CS 188: Artificial Intelligence Fall Preferences. MEU Principle. Rational Preferences. Utilities: Uncertain Outcomes
CS 188: Artificil Intelligence Fll 2011 Mximum Expected Utility Why hould we verge utilitie? Why not minimx? Lecture 8: Utilitie / MDP 9/20/2011 Dn Klein UC Berkeley Principle of mximum expected utility:
More informationPRICING CONVERTIBLE BONDS WITH KNOWN INTEREST RATE. Jong Heon Kim
Kngweon-Kyungki Mth. Jour. 14 2006, No. 2, pp. 185 202 PRICING CONVERTIBLE BONDS WITH KNOWN INTEREST RATE Jong Heon Kim Abstrct. In this pper, using the Blck-Scholes nlysis, we will derive the prtil differentil
More informationStatic Fully Observable Stochastic What action next? Instantaneous Perfect
CS 188: Ar)ficil Intelligence Mrkov Deciion Procee K+1 Intructor: Dn Klein nd Pieter Abbeel - - - Univerity of Cliforni, Berkeley [Thee lide were creted by Dn Klein nd Pieter Abbeel for CS188 Intro to
More informationChapter 2: Relational Model. Chapter 2: Relational Model
Chpter : Reltionl Model Dtbse System Concepts, 5 th Ed. See www.db-book.com for conditions on re-use Chpter : Reltionl Model Structure of Reltionl Dtbses Fundmentl Reltionl-Algebr-Opertions Additionl Reltionl-Algebr-Opertions
More informationWhat is Monte Carlo Simulation? Monte Carlo Simulation
Wht is Monte Crlo Simultion? Monte Crlo methods re widely used clss of computtionl lgorithms for simulting the ehvior of vrious physicl nd mthemticl systems, nd for other computtions. Monte Crlo lgorithm
More informationMulti-Step Reinforcement Learning: A Unifying Algorithm
Multi-Step Reinforcement Lerning: A Unifying Algorithm Kristopher De Asis, 1 J. Fernndo Hernndez-Grci, 1 G. Zchris Hollnd, 1 Richrd S. Sutton Reinforcement Lerning nd Artificil Intelligence Lbortory, University
More informationRecap: MDPs. CS 188: Artificial Intelligence Fall Optimal Utilities. The Bellman Equations. Value Estimates. Practice: Computing Actions
CS 188: Artificil Intelligence Fll 2008 Lecture 10: MDP 9/30/2008 Dn Klein UC Berkeley Recp: MDP Mrkov deciion procee: Stte S Action A Trnition P(,) (or T(,, )) Rewrd R(,, ) (nd dicount γ) Strt tte 0 Quntitie:
More informationAnnouncements. CS 188: Artificial Intelligence Fall Reinforcement Learning. Markov Decision Processes. Example Optimal Policies.
CS 188: Artificil Intelligence Fll 2008 Lecture 9: MDP 9/25/2008 Announcement Homework olution / review eion: Mondy 9/29, 7-9pm in 2050 Vlley LSB Tuedy 9/0, 6-8pm in 10 Evn Check web for detil Cover W1-2,
More informationAnnouncements. Maximizing Expected Utility. Preferences. Rational Preferences. Rational Preferences. Introduction to Artificial Intelligence
Introduction to Artificil Intelligence V22.0472-001 Fll 2009 Lecture 8: Utilitie Announcement Will hve Aignment 1 grded by Wed. Aignment 2 i up on webpge Due on Mon 19 th October (2 week) Rob Fergu Dept
More informationAddition and Subtraction
Addition nd Subtrction Nme: Dte: Definition: rtionl expression A rtionl expression is n lgebric expression in frction form, with polynomils in the numertor nd denomintor such tht t lest one vrible ppers
More informationINF 4130 Exercise set 4
INF 4130 Exercise set 4 Exercise 1 List the order in which we extrct the nodes from the Live Set queue when we do redth first serch of the following grph (tree) with the Live Set implemented s LIFO queue.
More information4/30/2012. Overview. MDPs. Planning Agent. Grid World. Review: Expectimax. Introduction & Agents Search, Heuristics & CSPs Adversarial Search
Overview CSE 473 Mrkov Deciion Procee Dn Weld Mny lide from Chri Bihop, Mum, Dn Klein, Sturt Ruell, Andrew Moore & Luke Zettlemoyer Introduction & Agent Serch, Heuritic & CSP Adverril Serch Logicl Knowledge
More informationResearch Article Existence of Positive Solution to Second-Order Three-Point BVPs on Time Scales
Hindwi Publishing Corportion Boundry Vlue Problems Volume 2009, Article ID 685040, 6 pges doi:10.1155/2009/685040 Reserch Article Existence of Positive Solution to Second-Order hree-point BVPs on ime Scles
More informationTime Scales: From Nabla Calculus to Delta Calculus and Vice Versa via Duality
Interntionl Journl of Difference Equtions ISSN 0973-6069, Volume 5, Number 1, pp. 25 40 (2010) http://cmpus.mst.edu/ijde Time Scles: From Nbl Clculus to Delt Clculus nd Vice Vers vi Dulity M. Cristin Cputo
More informationUNIT 7 SINGLE SAMPLING PLANS
UNIT 7 SINGLE SAMPLING PLANS Structure 7. Introduction Objectives 7. Single Smpling Pln 7.3 Operting Chrcteristics (OC) Curve 7.4 Producer s Risk nd Consumer s Risk 7.5 Averge Outgoing Qulity (AOQ) 7.6
More informationBurrows-Wheeler Transform and FM Index
Burrows-Wheeler Trnsform nd M Index Ben ngmed You re free to use these slides. If you do, plese sign the guestbook (www.lngmed-lb.org/teching-mterils), or emil me (ben.lngmed@gmil.com) nd tell me briefly
More information(a) by substituting u = x + 10 and applying the result on page 869 on the text, (b) integrating by parts with u = ln(x + 10), dv = dx, v = x, and
Supplementry Questions for HP Chpter 5. Derive the formul ln( + 0) d = ( + 0) ln( + 0) + C in three wys: () by substituting u = + 0 nd pplying the result on pge 869 on the tet, (b) integrting by prts with
More informationContinuous Optimal Timing
Srlnd University Computer Science, Srbrücken, Germny My 6, 205 Outline Motivtion Preliminries Existing Algorithms Our Algorithm Empiricl Evlution Conclusion Motivtion Probbilistic models unrelible/unpredictble
More informationFully Observable. Perfect
CS 188: Ar)ficil Intelligence Mrkov Deciion Procee II Stoch)c Plnning: MDP Sttic Environment Fully Obervble Perfect Wht ction next? Stochtic Intntneou Intructor: Dn Klein nd Pieter Abbeel - - - Univerity
More informationOption exercise with temptation
Economic Theory 2008) 34: 473 501 DOI 10.1007/s00199-006-0194-3 RESEARCH ARTICLE Jinjun Mio Option exercise with tempttion Received: 25 Jnury 2006 / Revised: 5 December 2006 / Published online: 10 Jnury
More informationUNIVERSITY OF NOTTINGHAM. Discussion Papers in Economics BERTRAND VS. COURNOT COMPETITION IN ASYMMETRIC DUOPOLY: THE ROLE OF LICENSING
UNIVERSITY OF NOTTINGHAM Discussion Ppers in Economics Discussion Pper No. 0/0 BERTRAND VS. COURNOT COMPETITION IN ASYMMETRIC DUOPOLY: THE ROLE OF LICENSING by Arijit Mukherjee April 00 DP 0/0 ISSN 160-48
More informationUNinhabited aerial vehicles (UAVs) are becoming increasingly
A Process Algebr Genetic Algorithm Sertc Krmn Tl Shim Emilio Frzzoli Abstrct A genetic lgorithm tht utilizes process lgebr for coding of solution chromosomes nd for defining evolutionry bsed opertors is
More informationOn-demand, Spot, or Both: Dynamic Resource Allocation for Executing Batch Jobs in the Cloud
On-demnd, Spot, or Both: Dynmic Resource Alloction for Executing Btch Jobs in the Cloud Ishi Menche Microsoft Reserch Ohd Shmir Weizmnn Institute Nvendu Jin Microsoft Reserch Abstrct Cloud computing provides
More informationOutline. CSE 326: Data Structures. Priority Queues Leftist Heaps & Skew Heaps. Announcements. New Heap Operation: Merge
CSE 26: Dt Structures Priority Queues Leftist Heps & Skew Heps Outline Announcements Leftist Heps & Skew Heps Reding: Weiss, Ch. 6 Hl Perkins Spring 2 Lectures 6 & 4//2 4//2 2 Announcements Written HW
More informationProblem Set for Chapter 3: Simple Regression Analysis ECO382 Econometrics Queens College K.Matsuda
Problem Set for Chpter 3 Simple Regression Anlysis ECO382 Econometrics Queens College K.Mtsud Excel Assignments You re required to hnd in these Excel Assignments by the due Mtsud specifies. Legibility
More information3/1/2016. Intermediate Microeconomics W3211. Lecture 7: The Endowment Economy. Today s Aims. The Story So Far. An Endowment Economy.
1 Intermedite Microeconomics W3211 Lecture 7: The Endowment Economy Introduction Columbi University, Spring 2016 Mrk Den: mrk.den@columbi.edu 2 The Story So Fr. 3 Tody s Aims 4 Remember: the course hd
More informationDo We Really Need Gaussian Filters for Feature Detection? (Supplementary Material)
Do We Relly Need Gussin Filters for Feture Detection? (Supplementry Mteril) Lee-Kng Liu, Stnley H. Chn nd Truong Nguyen Februry 5, 0 This document is supplementry mteril to the pper submitted to EUSIPCO
More informationMenu costs, firm size and price rigidity
Economics Letters 66 (2000) 59 63 www.elsevier.com/ locte/ econbse Menu costs, firm size nd price rigidity Robert A. Buckle *, John A. Crlson, b School of Economics nd Finnce, Victori University of Wellington,
More informationControlling a population of identical MDP
Controlling popultion of identicl MDP Nthlie Bertrnd Inri Rennes ongoing work with Miheer Dewskr (CMI), Blise Genest (IRISA) nd Hugo Gimert (LBRI) Trends nd Chllenges in Quntittive Verifiction Mysore,
More informationOptimal incentive contracts under loss aversion and inequity aversion
Fuzzy Optim Decis Mking https://doi.org/10.1007/s10700-018-9288-1 Optiml incentive contrcts under loss version nd inequity version Chi Zhou 1 Jin Peng 2 Zhibing Liu 2 Binwei Dong 3 Springer Science+Business
More informationArithmetic and Geometric Sequences
Arithmetic nd Geometric Sequences A sequence is list of numbers or objects, clled terms, in certin order. In n rithmetic sequence, the difference between one term nd the next is lwys the sme. This difference
More informationSTAT 472 Fall 2016 Test 2 November 8, 2016
STAT 47 Fll 016 Test November 8, 016 1. Anne who is (65) buys whole life policy with deth benefit of 00,000 pyble t the end of the yer of deth. The policy hs nnul premiums pyble for life. The premiums
More informationOptimal firm's policy under lead time- and price-dependent demand: interest of customers rejection policy
Optiml firm's policy under led time- nd price-dependent demnd: interest of customers rejection policy Abduh Syid Albn Université Grenoble Alpes, G-SCOP, F-38000 Grenoble, Frnce bduh-syid.lbn@grenoble-inp.org
More informationA Static Model for Voting on Social Security
A Sttic Model for Voting on Socil Security Henning Bohn Deprtment of Economics University of Cliforni t Snt Brbr Snt Brbr, CA 93106, USA; nd CESifo Phone: 1-805-893-4532; Fx: 1-805-893-8830. E-mil: bohn@econ.ucsb.edu
More informationInformation Acquisition and Disclosure: the Case of Differentiated Goods Duopoly
Informtion Acquisition nd Disclosure: the Cse of Differentited Goods Duopoly Snxi Li Jinye Yn Xundong Yin We thnk Dvid Mrtimort, Thoms Mriotti, Ptrick Rey, Wilfried Snd-Zntmn, Frnces Xu nd Yongsheng Xu
More informationECON 105 Homework 2 KEY Open Economy Macroeconomics Due November 29
Instructions: ECON 105 Homework 2 KEY Open Economy Mcroeconomics Due Novemer 29 The purpose of this ssignment it to integrte the explntions found in chpter 16 ok Kennedy with the D-S model nd the Money
More information164 CHAPTER 2. VECTOR FUNCTIONS
164 CHAPTER. VECTOR FUNCTIONS.4 Curvture.4.1 Definitions nd Exmples The notion of curvture mesures how shrply curve bends. We would expect the curvture to be 0 for stright line, to be very smll for curves
More informationThis paper is not to be removed from the Examination Halls UNIVERSITY OF LONDON
~~FN3092 ZA 0 his pper is not to be remove from the Exmintion Hlls UNIESIY OF LONDON FN3092 ZA BSc egrees n Diploms for Grutes in Economics, Mngement, Finnce n the Socil Sciences, the Diploms in Economics
More informationA portfolio approach to the optimal funding of pensions
Economics Letters 69 (000) 01 06 www.elsevier.com/ locte/ econbse A portfolio pproch to the optiml funding of pensions Jysri Dutt, Sndeep Kpur *, J. Michel Orszg b, b Fculty of Economics University of
More informationOn the Complexity of Computing the Justification Status of an Argument
On the Complexity of Computing the Justifiction Sttus of n Argument dbi Reserch Seminr, Vienn Wolfgng Dvořák Institute of Informtion Systems, Vienn University of Technology Oct 13, 2011 Supported by the
More informationMath 205 Elementary Algebra Fall 2010 Final Exam Study Guide
Mth 0 Elementr Algebr Fll 00 Finl Em Stud Guide The em is on Tuesd, December th from :0m :0m. You re llowed scientific clcultor nd " b " inde crd for notes. On our inde crd be sure to write n formuls ou
More informationMIXED OLIGOPOLIES AND THE PROVISION OF DURABLE GOODS. Baranovskyi Volodymyr. MA in Economic Analysis. Kyiv School of Economics
MIXED OLIGOPOLIES AND THE PROVISION OF DURABLE GOODS by Brnovskyi Volodymyr A thesis submitted in prtil fulfillment of the requirements for the degree of MA in Economic Anlysis Kyiv School of Economics
More informationComplete the table below to show the fixed, variable and total costs. In the final column, calculate the profit or loss made by J Kane.
Tsk 1 J Kne sells mchinery to the frm industry. His fixed costs re 10,000 nd ech mchine costs him 400 to buy. He sells them t 600 nd is trying to work out his profit or loss t vrious levels of sles. He
More informationDecision Making Under Uncertainty
CSC384: Intro to Artificil Intelligence Preferences Decision Mking Under Uncertinty Decision Trees DBN: 15.1 nd 15.5 Decision Network: 16.1,16.2,16.5,16.6 I give root plnning prolem: I wnt coffee ut coffee
More informationMeasuring Search Trees
Mesuring Serch Trees Christin Bessiere 1, Bruno Znuttini 2, nd Cèsr Fernández 3 1 LIRMM-CNRS, Montpellier, Frnce 2 GREYC, Cen, Frnce 3 Univ. de Lleid, Lleid, Spin Astrct. The SAT nd CSP communities mke
More informationTechnical Report Global Leader Dry Bulk Derivatives. FIS Technical - Grains And Ferts. Highlights:
Technicl Report Technicl Anlyst FIS Technicl - Grins And Ferts Edwrd Hutn 44 20 7090 1120 Edwrdh@freightinvesr.com Highlights: SOY The weekly chrt is chowing lower high suggesting wekness going forwrd,
More informationPreference Cloud Theory: Imprecise Preferences and Preference Reversals Oben Bayrak and John Hey
Preference Cloud Theory: Imprecise Preferences nd Preference Reversls Oben Byrk nd John Hey This pper presents new theory, clled Preference Cloud Theory, of decision-mking under uncertinty. This new theory
More informationA Closer Look at Bond Risk: Duration
W E B E X T E S I O 4C A Closer Look t Bond Risk: Durtion This Extension explins how to mnge the risk of bond portfolio using the concept of durtion. BOD RISK In our discussion of bond vlution in Chpter
More informationNotes on the BENCHOP implementations for the COS method
Notes on the BENCHOP implementtions for the COS method M. J. uijter C. W. Oosterlee Mrch 29, 2015 Abstrct This text describes the COS method nd its implementtion for the BENCHOP-project. 1 Fourier cosine
More informationproduction for Community & Culture Project Reference e 2 design episodes Bogotá: Building a Sustainable City and Affordable Green Housing.
Community & Culture Project Reference e 2 design episodes Bogotá: Building Sustinble City nd Affordble Green Housing. 1) Red the bckground essy nd discussion questions for e 2 design episodes Bogotá: Building
More informationBuckling of Stiffened Panels 1 overall buckling vs plate buckling PCCB Panel Collapse Combined Buckling
Buckling of Stiffened Pnels overll uckling vs plte uckling PCCB Pnel Collpse Comined Buckling Vrious estimtes hve een developed to determine the minimum size stiffener to insure the plte uckles while the
More informationTechnical Appendix. The Behavior of Growth Mixture Models Under Nonnormality: A Monte Carlo Analysis
Monte Crlo Technicl Appendix 1 Technicl Appendix The Behvior of Growth Mixture Models Under Nonnormlity: A Monte Crlo Anlysis Dniel J. Buer & Ptrick J. Currn 10/11/2002 These results re presented s compnion
More informationAsset finance (US) Opportunity. Flexibility. Planning. Develop your capabilities using the latest equipment
Asset finnce (US) Opportunity Develop your cpbilities using the ltest equipment Flexibility Mnge your cshflow nd ccess the technology you need Plnning Mnge your investment with predictble costs nd plnned
More informationChapter 4. Profit and Bayesian Optimality
Chpter 4 Profit nd Byesin Optimlity In this chpter we consider the objective of profit. The objective of profit mximiztion dds significnt new chllenge over the previously considered objective of socil
More informationPushdown Automata. Courtesy: Costas Busch RPI
Pushdown Automt Courtesy: Costs Busch RPI Pushdown Automt Pushdown Automt Pushdown Automt Pushdown Automt Pushdown Automt Pushdown Automt Non-Determinism:NPDA PDAs re non-deterministic: non-deterministic
More informationarxiv: v1 [cs.lg] 23 Jan 2019
Robust temporl difference lerning for criticl domins rxiv:1901.08021v1 [cs.lg] 23 Jn 2019 Richrd Klim University of Liverpool, UK richrd.klim@liverpool.c.uk Michel Kisers Centrum Wiskunde & Informtic,
More informationThe Market Approach to Valuing Businesses (Second Edition)
BV: Cse Anlysis Completed Trnsction & Guideline Public Comprble MARKET APPROACH The Mrket Approch to Vluing Businesses (Second Edition) Shnnon P. Prtt This mteril is reproduced from The Mrket Approch to
More informationOptimal Cost Sharing Protocols for Scheduling Games
Optiml Cost Shring Protocols for Scheduling Gmes Philipp von Flkenhusen Berlin Institute of Technology Institute of Mthemtics p.flkenhusen@gmil.com Tobis Hrks Berlin Institute of Technology Institute of
More informationDatabase System Concepts, 5 th Ed. Silberschatz, Korth and Sudarshan See for conditions on re-use
Chpter 2: Reltionl Model Dtbse System Concepts, 5 th Ed. See www.db-book.com for conditions on re-use Bnking Exmple brnch (brnch_nme, brnch_city, ssets) customer (customer_nme, customer_street, customer_city)
More informationFractal Analysis on the Stock Price of C to C Electronic Commerce Enterprise Ming Chen
6th Interntionl Conference on Electronic, Mechnicl, Informtion nd Mngement (EMIM 2016) Frctl Anlysis on the Stock Price of C to C Electronic Commerce Enterprise Ming Chen Soochow University, Suzhou, Chin
More informationThe Option-Critic Architecture
The Option-Critic Architecture Pierre-Luc Bcon nd Jen Hrb nd Doin Precup Resoning nd Lerning Lb, School of Computer Science McGill University {pbcon, jhrb, dprecup}@cs.mcgill.c Preliminries nd Nottion
More informationA ppendix to. I soquants. Producing at Least Cost. Chapter
A ppendix to Chpter 0 Producing t est Cost This ppendix descries set of useful tools for studying firm s long-run production nd costs. The tools re isoqunts nd isocost lines. I soqunts FIGURE A0. SHOWS
More informationTechnical Report Global Leader Dry Bulk Derivatives. FIS Technical - Grains And Ferts. Highlights:
Technicl Report Technicl Anlyst FIS Technicl - Grins And Ferts Edwrd Hutn 442070901120 Edwrdh@freightinvesr.com Client Reltions Andrew Cullen 442070901120 Andrewc@freightinvesr.com Highlights: SOY remins
More informationof Manchester The University START of Manchester The University
/3/0 COMP4 Lecure 8 Hidden Mrkov Models Hidden Mrkov Models Imgine he s nd s re hidden, so he d roduced is sequence of nd D generion is esy, -------- D decoding is miguous,? Ses emi feures or, u heir originis
More informationNews Release Half-year Results 20 February Review of results and operations. Excluding significant items a
News Relese 2018 Hlf-yer Results 20 Februry 2018 Review of results nd opertions Hlf-yer ended 31 December 2017 Reported Excluding significnt items Vrince to pcp (exc. sig. items) Operting revenue $35.9b
More informationToday s Outline. One More Operation. Priority Queues. New Operation: Merge. Leftist Heaps. Priority Queues. Admin: Priority Queues
Tody s Outline Priority Queues CSE Dt Structures & Algorithms Ruth Anderson Spring 4// Admin: HW # due this Thursdy / t :9pm Printouts due Fridy in lecture. Priority Queues Leftist Heps Skew Heps 4// One
More informationTHE FINAL PROOF SUPPORTING THE TURNOVER FORMULA.
THE FINAL PROOF SUPPORTING THE TURNOVER FORMULA. I would like to thnk Aris for his mthemticl contriutions nd his swet which hs enled deeper understnding of the turnover formul to emerge. His contriution
More informationProblem Set 4 - Solutions. Suppose when Russia opens to trade, it imports automobiles, a capital-intensive good.
roblem Set 4 - Solutions uestion Suppose when ussi opens to trde, it imports utomobiles, cpitl-intensive good. ) According to the Heckscher-Ohlin theorem, is ussi cpitl bundnt or lbor bundnt? Briefly explin.
More informationPairwise sequence comparison. Global alignment with linear gap cost
Pirwise sequence comprison Globl linment with liner p cost DNA sequences The humn enome 5 cells, ech contins 3 pirs of chromosomes, DNA molecules, which stores enetic informtion... GGCCTAAAGGCGCCGGTCTT
More informationTble 1: Syntx of LOTOS/T+ E :: stop (untimed dedlock) j exit (successful termintion) j ; E (ction prex, untimed) j [P (t; x)]; E (ction prex, timed) j
Protocol Synthesis from Timed nd Structured Specictions Akio Nkt Teruo Higshino Kenichi Tniguchi Dept. of Informtion nd Computer Sciences, Osk University Toyonk, Osk 56, Jpn Abstrct In this pper, we propose
More informationThe Combinatorial Seller s Bid Double Auction: An Asymptotically Efficient Market Mechanism*
The Combintoril Seller s Bid Double Auction: An Asymptoticlly Efficient Mret Mechnism* Rhul Jin IBM Wtson Reserch Hwthorne, NY rhul.jin@us.ibm.com Prvin Vriy EECS Deprtment University of Cliforni, Bereley
More informationBehavioural Differential Equations and Coinduction for Binary Trees
Behviourl Differentil Equtions nd Coinduction for Binry Trees Alexndr Silv nd Jn Rutten,2 Centrum voor Wiskunde en Informtic (CWI) 2 Vrije Universiteit Amsterdm (VUA) {ms,jnr}@cwi.nl Abstrct. We study
More informationNORTH YORKSHIRE PENSION FUND GOVERNANCE COMPLIANCE STATEMENT
NORTH YORKSHIRE PENSION FUND GOVERNANCE COMPLIANCE STATEMENT TABLE OF CONTENTS Section Pge 1 INTRODUCTION 2 2 GOVERNANCE ARRANGEMENTS 2 3 REPRESENTATION AND MEETINGS 4 4 OPERATIONAL PROCEDRES 5 5 KEY POLICY
More information1. Detailed information about the Appellant s and Respondent s personal information including mobile no. and -id are to be furnished.
Revised Form 36 nd Form 36A for filing ppel nd cross objection respectively before income tx ppellte tribunl (Notifiction No. 72 dted 23.10.2018) Bckground CBDT issued drft notifiction vide press relese
More informationPSAS: Government transfers what you need to know
PSAS: Government trnsfers wht you need to know Ferury 2018 Overview This summry will provide users with n understnding of the significnt recognition, presenttion nd disclosure requirements of the stndrd.
More informationTechnical Report Global Leader Dry Bulk Derivatives. FIS Technical - Grains And Ferts. Highlights:
Technicl Report Technicl Anlyst FIS Technicl - Grins And Ferts Edwrd Hutn 44 20 7090 1120 Edwrdh@freightinvesr.com Highlights: SOY The weekly schstic is wrning slowing momentum in the mrket. USD 966 ¼
More informationFINANCIAL ANALYSIS I. INTRODUCTION AND METHODOLOGY
Dhk Wter Supply Network Improvement Project (RRP BAN 47254003) FINANCIAL ANALYSIS I. INTRODUCTION AND METHODOLOGY A. Introduction 1. The Asin Development Bnk (ADB) finncil nlysis of the proposed Dhk Wter
More informationNo. 27 / October Ebert, Michael / Kadane, Joseph B. / Simons, Dirk / Stecher, Jack D. Disclosure and Rollover Risk
No. 27 / October 2017 Ebert, Michel / Kdne, Joseph B. / Simons, Dirk / Stecher, Jck D. Disclosure nd Rollover Risk Disclosure nd Rollover Risk Michel Ebert 1 Joseph B. Kdne 2 Dirk Simons 3 Jck D. Stecher
More informationOptimal Redistributive Taxation in a Search Equilibrium Model.
Optiml Redistributive Txtion in Serch Equilibrium Model. Mthis HUNGERBÜHLER mthis.hungerbuhler@fundp.c.be Alexis PARMENTIER cdb prment@univ-pris1.fr November 16, 2005 Etienne LEHMANN bce elehmnn@u-pris2.fr
More informationEffects of Entry Restriction on Free Entry General Competitive Equilibrium. Mitsuo Takase
CAES Working Pper Series Effects of Entry Restriction on Free Entry Generl Competitive Euilirium Mitsuo Tkse Fculty of Economics Fukuok University WP-2018-006 Center for Advnced Economic Study Fukuok University
More informationInsurance: Mathematics and Economics
Insurnce: Mthemtics nd Economics 43 008) 303 315 Contents lists vilble t ScienceDirect Insurnce: Mthemtics nd Economics journl homepge: www.elsevier.com/locte/ime he design of equity-indexed nnuities Phelim
More informationThis paper is not to be removed from the Examination Halls
This pper is not to be remove from the Exmintion Hlls UNIVESITY OF LONON FN3092 ZB (279 0092) BSc egrees n iploms for Grutes in Economics, Mngement, Finnce n the Socil Sciences, the iploms in Economics
More informationBequest motives and fertility decisions B
Economics Letters 92 (2006) 348 352 www.elsevier.com/locte/econbse Bequest motives nd fertility decisions B Ritsuko Futgmi, Kimiyoshi Kmd b, *, Tkshi Sto c Deprtment of Mngement Informtion Systems, Chubu
More information