3: Inventory management

Size: px
Start display at page:

Download "3: Inventory management"

Transcription

1 INSE6300 Ji Yun Yu 3: Inventory mngement Concordi Februry 9, 2016 Supply chin mngement is bout mking sequence of decisions over sequence of time steps, fter mking observtions t ech of these time steps. We illustrte this with the problem of mnging n inventory of nonperishble goods when demnd is stochstic. We first need to introduce the notion of Mrkov chins (e.g., wether model, coupon collector, etc.). Figure 1: From wether-model.png 1 Numericl exmple Consider the lst horse-drwn crrige deler in the world, which just took lese of N = 4 months on showroom. At time t = 1, 2, 3, 4, the strting inventory level is s t, the order size is t, nd the rndom demnd is d t. The rndom vribles {d t } re i.i.d. with the following distribution: 0 w.p. 0.1, d t = 1 w.p. 0.7, 2 w.p

2 Figure 2: From exportersindi.com The inventory level t the next time step t + 1 evolves ccording to the following Mrkov process: 0 if s t + t d t < 0, s t+1 = s t + t d t if 0 s t + t d t 2, (1) 2 if s t + t d t > 2. Suppose tht the ordering cost of ech unit of inventory is 1, nd tht both the holding nd bckorder costs re qudrtic, the overll cost is c(s t, t, d t ) = t + (s t + t d t ) 2. Unsold inventory hs no slvge vlue. Bckwrd induction strts t t = N = 4, nd ssigns vlue to ech inventory stte. Since unsold inventory hs no slvge vlue, we hve V 4 (0) = V 4 (1) = V 4 (2) = 0. For t = 1, 2, 3, we ssign the following vlues to the sttes: V t (s) = min E{c(s,, d t ) + V t+1 (s t+1 )} = min E{c(s,, d t ) + V t+1 ([s + d t ] 2 0)}, where we used the definition of s t+1 in (1) nd the nottion [ ] 2 0 to clmp to stte to the llowed rnge. Nmely, for t = 3, using the distribution of d t bove, we obtin V 3 (s) = min E{c(s,, d 3 ) + V 4 (s 4 )} = min E{ + (s + d t ) 2 + 0} ( = min + 0.1(s + 0) (s + 1) (s + 2) ), 2 2

3 nd The optiml order sizes re Repet for t = 2 nd t = 1: 1.3 if s = 0, V 3 (s) = 0.3 if s = 1, 1.1 if s = 2. 3(s) = 0 if s = 1, 2.5 if s = 0, V 2 (s) = 1.5 if s = 1, 1.68 if s = 2. 2(s) = 0 if s = 1, 3.7 if s = 0, V 1 (s) = 2.7 if s = 1, if s = 2. 1(s) = 0 if s = 1, Observe tht the optiml order size is 1 if the current inventory is 0, nd 0 otherwise. 2 Stochstic inventory mngement Consider single product (e.g., crs), nd discrete time steps (e.g., months 1, 2, etc.). Every time step (e.g., every month), the decision mker oberserves the current inventory level, nd decides how much inventory to order from the supplier. There re costs for holding inventory. The demnd is rndom, but we know the distribution of the rndom vrible. The gol is mximize the expected vlue of the profit (revenue minus costs) over number N of months. Assumptions: Delivery is instntneous (no led-time); The demnd tke integer vlues; 3

4 The demnd is i.i.d. with given distribution p j = P(D t = j) for j = 0, 1,...; Inventory hs cpcity M. For time steps t = 1, 2,..., let s t denote the inventory level, t the order size, nd D t the demnd t time t these re ll integer-vlued. The inventory level from one time step to the next follows this dynmics: The rewrd or profit t time t is s t+1 = mx{s t + t D t, 0}. r t (s t, t ) = F (s t + t ) O( t ) h(s t + t ), for t = 1,..., N 1, present vlue of inventory order holding r N (s N, N ) = g(s N, N ). slvge vlue where the expected present vlue of inventory is F (z) = z 1 j=0 f(j) revenue from j sles p j + j z f(z) p k, for z = 0, 1,... revenue cpped to z sles The order nd holding cost function cn be rbitrry; for instnce, O(z) = [K + c(z)]1 [z>0]. Remrk 1. Bckorder costs (missed sles) re implicitly ccounted for in the profit. 2.1 MDP We cn describe the stochstic inventory mngement problem s n MDP. The inputs re: Holding cost function h, order cost O, sles revenue f, slvge revenue g; Probbilities p 0, p 1,...; Time horizon: {1, 2,..., N}; Stte spce: S = {0, 1,..., M}; Action spce: A = {0, 1,..., M}; Expected rewrd: r 1, r 2,..., r N ; Stte trnsition probbilities: P (s s, ) = 0 if s (s +, M], p s+ s if s (0, s + ] nd s + M, k>s+ p k if s = 0 nd s + M. This is the probbility of hving n inventory level s t the next time step when the inventory level t the current time step is s nd we order units of inventory. 4

5 The output is optiml sequence of policies σ 1, σ 2,..., where σ j : S A. These policies re used to pick the optiml ction to tke t ech time step: suppose tht t time t = 1, 2,..., N, we observe the stte s t ( rndom vrible), then the optiml ction is σ t (s t ). Remrk 2 (Rewrd vs cost). We cn define the MDP in terms of costs by replcing the expected rewrd by expected cost, s in the numericl exmple bove, nd by replcing the mx by min. 2.2 Solving finite-horizon MDP by bckwrd induction How do we compute the optiml policies σ 1, σ 2,...? We propose method of dynmic progrmming clled bckwrd induction. The bckwrd induction lgorithm for MDPs proceeds s follows. 1. Set j = N, nd V N (s) = mx A r N (s, ) = g(s) for ll s S; 2. For j = N 1, N 2,..., 1: () For s S: i. Compute V j (s) = mx A { r j (s, ) + s S P (s s, )V j+1 (s) } ; ii. Output σ j (s) rg mx A { rj (s, ) + s S P (s s, )V j+1 (s) }. The output policies σ 1,..., σ N re optiml (cf. Putermn, Section 4.3). 3 References Mrkov Decision Processes, M. Putermn, Chpter 1. 5

Chapter 3: The Reinforcement Learning Problem. The Agent'Environment Interface. Getting the Degree of Abstraction Right. The Agent Learns a Policy

Chapter 3: The Reinforcement Learning Problem. The Agent'Environment Interface. Getting the Degree of Abstraction Right. The Agent Learns a Policy Chpter 3: The Reinforcement Lerning Problem The Agent'Environment Interfce Objectives of this chpter: describe the RL problem we will be studying for the reminder of the course present idelized form of

More information

DYNAMIC PROGRAMMING REINFORCEMENT LEARNING. COGS 202 : Week 7 Presentation

DYNAMIC PROGRAMMING REINFORCEMENT LEARNING. COGS 202 : Week 7 Presentation DYNAMIC PROGRAMMING REINFORCEMENT LEARNING COGS 202 : Week 7 Preenttion OUTLINE Recp (Stte Vlue nd Action Vlue function) Computtion in MDP Dynmic Progrmming (DP) Policy Evlution Policy Improvement Policy

More information

CS 188 Introduction to Artificial Intelligence Fall 2018 Note 4

CS 188 Introduction to Artificial Intelligence Fall 2018 Note 4 CS 188 Introduction to Artificil Intelligence Fll 2018 Note 4 These lecture notes re hevily bsed on notes originlly written by Nikhil Shrm. Non-Deterministic Serch Picture runner, coming to the end of

More information

Reinforcement Learning. CS 188: Artificial Intelligence Fall Grid World. Markov Decision Processes. What is Markov about MDPs?

Reinforcement Learning. CS 188: Artificial Intelligence Fall Grid World. Markov Decision Processes. What is Markov about MDPs? CS 188: Artificil Intelligence Fll 2010 Lecture 9: MDP 9/2/2010 Reinforcement Lerning [DEMOS] Bic ide: Receive feedbck in the form of rewrd Agent utility i defined by the rewrd function Mut (lern to) ct

More information

9.3. Regular Languages

9.3. Regular Languages 9.3. REGULAR LANGUAGES 139 9.3. Regulr Lnguges 9.3.1. Properties of Regulr Lnguges. Recll tht regulr lnguge is the lnguge ssocited to regulr grmmr, i.e., grmmr G = (N, T, P, σ) in which every production

More information

A Fuzzy Inventory Model With Lot Size Dependent Carrying / Holding Cost

A Fuzzy Inventory Model With Lot Size Dependent Carrying / Holding Cost IOSR Journl of Mthemtics (IOSR-JM e-issn: 78-578,p-ISSN: 9-765X, Volume 7, Issue 6 (Sep. - Oct. 0, PP 06-0 www.iosrournls.org A Fuzzy Inventory Model With Lot Size Dependent Crrying / olding Cost P. Prvthi,

More information

Gridworld Values V* Gridworld: Q*

Gridworld Values V* Gridworld: Q* CS 188: Artificil Intelligence Mrkov Deciion Procee II Intructor: Dn Klein nd Pieter Abbeel --- Univerity of Cliforni, Berkeley [Thee lide were creted by Dn Klein nd Pieter Abbeel for CS188 Intro to AI

More information

Cache CPI and DFAs and NFAs. CS230 Tutorial 10

Cache CPI and DFAs and NFAs. CS230 Tutorial 10 Cche CPI nd DFAs nd NFAs CS230 Tutoril 10 Multi-Level Cche: Clculting CPI When memory ccess is ttempted, wht re the possible results? ccess miss miss CPU L1 Cche L2 Cche Memory L1 cche hit L2 cche hit

More information

Outline. CS 188: Artificial Intelligence Spring Speeding Up Game Tree Search. Minimax Example. Alpha-Beta Pruning. Pruning

Outline. CS 188: Artificial Intelligence Spring Speeding Up Game Tree Search. Minimax Example. Alpha-Beta Pruning. Pruning CS 188: Artificil Intelligence Spring 2011 Lecture 8: Gme, MDP 2/14/2010 Pieter Abbeel UC Berkeley Mny lide dpted from Dn Klein Outline Zero-um determinitic two plyer gme Minimx Evlution function for non-terminl

More information

Smart Investment Strategies

Smart Investment Strategies Smrt Investment Strtegies Risk-Rewrd Rewrd Strtegy Quntifying Greed How to mke good Portfolio? Entrnce-Exit Exit Strtegy: When to buy? When to sell? 2 Risk vs.. Rewrd Strtegy here is certin mount of risk

More information

CH 71 COMPLETING THE SQUARE INTRODUCTION FACTORING PERFECT SQUARE TRINOMIALS

CH 71 COMPLETING THE SQUARE INTRODUCTION FACTORING PERFECT SQUARE TRINOMIALS CH 7 COMPLETING THE SQUARE INTRODUCTION I t s now time to py our dues regrding the Qudrtic Formul. Wht, you my sk, does this men? It mens tht the formul ws merely given to you once or twice in this course,

More information

Chapter55. Algebraic expansion and simplification

Chapter55. Algebraic expansion and simplification Chpter55 Algebric expnsion nd simplifiction Contents: A The distributive lw B The product ( + b)(c + d) C Difference of two squres D Perfect squres expnsion E Further expnsion F The binomil expnsion 88

More information

Announcements. CS 188: Artificial Intelligence Fall Recap: MDPs. Recap: Optimal Utilities. Practice: Computing Actions. Recap: Bellman Equations

Announcements. CS 188: Artificial Intelligence Fall Recap: MDPs. Recap: Optimal Utilities. Practice: Computing Actions. Recap: Bellman Equations CS 188: Artificil Intelligence Fll 2009 Lecture 10: MDP 9/29/2009 Announcement P2: Due Wednedy P3: MDP nd Reinforcement Lerning i up! W2: Out lte thi week Dn Klein UC Berkeley Mny lide over the coure dpted

More information

Roadmap of This Lecture

Roadmap of This Lecture Reltionl Model Rodmp of This Lecture Structure of Reltionl Dtbses Fundmentl Reltionl-Algebr-Opertions Additionl Reltionl-Algebr-Opertions Extended Reltionl-Algebr-Opertions Null Vlues Modifiction of the

More information

JFE Online Appendix: The QUAD Method

JFE Online Appendix: The QUAD Method JFE Online Appendix: The QUAD Method Prt of the QUAD technique is the use of qudrture for numericl solution of option pricing problems. Andricopoulos et l. (00, 007 use qudrture s the only computtionl

More information

MATH 236 ELAC MATH DEPARTMENT FALL 2017 SHORT ANSWER. Write the word or phrase that best completes each statement or answers the question.

MATH 236 ELAC MATH DEPARTMENT FALL 2017 SHORT ANSWER. Write the word or phrase that best completes each statement or answers the question. MATH 236 ELAC MATH DEPARTMENT FALL 2017 TEST 1 REVIEW SHORT ANSWER. Write the word or phrse tht best completes ech sttement or nswers the question. 1) The supply nd demnd equtions for certin product re

More information

Non-Deterministic Search. CS 188: Artificial Intelligence Markov Decision Processes. Grid World Actions. Example: Grid World

Non-Deterministic Search. CS 188: Artificial Intelligence Markov Decision Processes. Grid World Actions. Example: Grid World CS 188: Artificil Intelligence Mrkov Deciion Procee Non-Determinitic Serch Dn Klein, Pieter Abbeel Univerity of Cliforni, Berkeley Exmple: Grid World Grid World Action A mze-like problem The gent live

More information

Maximum Expected Utility. CS 188: Artificial Intelligence Fall Preferences. MEU Principle. Rational Preferences. Utilities: Uncertain Outcomes

Maximum Expected Utility. CS 188: Artificial Intelligence Fall Preferences. MEU Principle. Rational Preferences. Utilities: Uncertain Outcomes CS 188: Artificil Intelligence Fll 2011 Mximum Expected Utility Why hould we verge utilitie? Why not minimx? Lecture 8: Utilitie / MDP 9/20/2011 Dn Klein UC Berkeley Principle of mximum expected utility:

More information

PRICING CONVERTIBLE BONDS WITH KNOWN INTEREST RATE. Jong Heon Kim

PRICING CONVERTIBLE BONDS WITH KNOWN INTEREST RATE. Jong Heon Kim Kngweon-Kyungki Mth. Jour. 14 2006, No. 2, pp. 185 202 PRICING CONVERTIBLE BONDS WITH KNOWN INTEREST RATE Jong Heon Kim Abstrct. In this pper, using the Blck-Scholes nlysis, we will derive the prtil differentil

More information

Static Fully Observable Stochastic What action next? Instantaneous Perfect

Static Fully Observable Stochastic What action next?  Instantaneous Perfect CS 188: Ar)ficil Intelligence Mrkov Deciion Procee K+1 Intructor: Dn Klein nd Pieter Abbeel - - - Univerity of Cliforni, Berkeley [Thee lide were creted by Dn Klein nd Pieter Abbeel for CS188 Intro to

More information

Chapter 2: Relational Model. Chapter 2: Relational Model

Chapter 2: Relational Model. Chapter 2: Relational Model Chpter : Reltionl Model Dtbse System Concepts, 5 th Ed. See www.db-book.com for conditions on re-use Chpter : Reltionl Model Structure of Reltionl Dtbses Fundmentl Reltionl-Algebr-Opertions Additionl Reltionl-Algebr-Opertions

More information

What is Monte Carlo Simulation? Monte Carlo Simulation

What is Monte Carlo Simulation? Monte Carlo Simulation Wht is Monte Crlo Simultion? Monte Crlo methods re widely used clss of computtionl lgorithms for simulting the ehvior of vrious physicl nd mthemticl systems, nd for other computtions. Monte Crlo lgorithm

More information

Multi-Step Reinforcement Learning: A Unifying Algorithm

Multi-Step Reinforcement Learning: A Unifying Algorithm Multi-Step Reinforcement Lerning: A Unifying Algorithm Kristopher De Asis, 1 J. Fernndo Hernndez-Grci, 1 G. Zchris Hollnd, 1 Richrd S. Sutton Reinforcement Lerning nd Artificil Intelligence Lbortory, University

More information

Recap: MDPs. CS 188: Artificial Intelligence Fall Optimal Utilities. The Bellman Equations. Value Estimates. Practice: Computing Actions

Recap: MDPs. CS 188: Artificial Intelligence Fall Optimal Utilities. The Bellman Equations. Value Estimates. Practice: Computing Actions CS 188: Artificil Intelligence Fll 2008 Lecture 10: MDP 9/30/2008 Dn Klein UC Berkeley Recp: MDP Mrkov deciion procee: Stte S Action A Trnition P(,) (or T(,, )) Rewrd R(,, ) (nd dicount γ) Strt tte 0 Quntitie:

More information

Announcements. CS 188: Artificial Intelligence Fall Reinforcement Learning. Markov Decision Processes. Example Optimal Policies.

Announcements. CS 188: Artificial Intelligence Fall Reinforcement Learning. Markov Decision Processes. Example Optimal Policies. CS 188: Artificil Intelligence Fll 2008 Lecture 9: MDP 9/25/2008 Announcement Homework olution / review eion: Mondy 9/29, 7-9pm in 2050 Vlley LSB Tuedy 9/0, 6-8pm in 10 Evn Check web for detil Cover W1-2,

More information

Announcements. Maximizing Expected Utility. Preferences. Rational Preferences. Rational Preferences. Introduction to Artificial Intelligence

Announcements. Maximizing Expected Utility. Preferences. Rational Preferences. Rational Preferences. Introduction to Artificial Intelligence Introduction to Artificil Intelligence V22.0472-001 Fll 2009 Lecture 8: Utilitie Announcement Will hve Aignment 1 grded by Wed. Aignment 2 i up on webpge Due on Mon 19 th October (2 week) Rob Fergu Dept

More information

Addition and Subtraction

Addition and Subtraction Addition nd Subtrction Nme: Dte: Definition: rtionl expression A rtionl expression is n lgebric expression in frction form, with polynomils in the numertor nd denomintor such tht t lest one vrible ppers

More information

INF 4130 Exercise set 4

INF 4130 Exercise set 4 INF 4130 Exercise set 4 Exercise 1 List the order in which we extrct the nodes from the Live Set queue when we do redth first serch of the following grph (tree) with the Live Set implemented s LIFO queue.

More information

4/30/2012. Overview. MDPs. Planning Agent. Grid World. Review: Expectimax. Introduction & Agents Search, Heuristics & CSPs Adversarial Search

4/30/2012. Overview. MDPs. Planning Agent. Grid World. Review: Expectimax. Introduction & Agents Search, Heuristics & CSPs Adversarial Search Overview CSE 473 Mrkov Deciion Procee Dn Weld Mny lide from Chri Bihop, Mum, Dn Klein, Sturt Ruell, Andrew Moore & Luke Zettlemoyer Introduction & Agent Serch, Heuritic & CSP Adverril Serch Logicl Knowledge

More information

Research Article Existence of Positive Solution to Second-Order Three-Point BVPs on Time Scales

Research Article Existence of Positive Solution to Second-Order Three-Point BVPs on Time Scales Hindwi Publishing Corportion Boundry Vlue Problems Volume 2009, Article ID 685040, 6 pges doi:10.1155/2009/685040 Reserch Article Existence of Positive Solution to Second-Order hree-point BVPs on ime Scles

More information

Time Scales: From Nabla Calculus to Delta Calculus and Vice Versa via Duality

Time Scales: From Nabla Calculus to Delta Calculus and Vice Versa via Duality Interntionl Journl of Difference Equtions ISSN 0973-6069, Volume 5, Number 1, pp. 25 40 (2010) http://cmpus.mst.edu/ijde Time Scles: From Nbl Clculus to Delt Clculus nd Vice Vers vi Dulity M. Cristin Cputo

More information

UNIT 7 SINGLE SAMPLING PLANS

UNIT 7 SINGLE SAMPLING PLANS UNIT 7 SINGLE SAMPLING PLANS Structure 7. Introduction Objectives 7. Single Smpling Pln 7.3 Operting Chrcteristics (OC) Curve 7.4 Producer s Risk nd Consumer s Risk 7.5 Averge Outgoing Qulity (AOQ) 7.6

More information

Burrows-Wheeler Transform and FM Index

Burrows-Wheeler Transform and FM Index Burrows-Wheeler Trnsform nd M Index Ben ngmed You re free to use these slides. If you do, plese sign the guestbook (www.lngmed-lb.org/teching-mterils), or emil me (ben.lngmed@gmil.com) nd tell me briefly

More information

(a) by substituting u = x + 10 and applying the result on page 869 on the text, (b) integrating by parts with u = ln(x + 10), dv = dx, v = x, and

(a) by substituting u = x + 10 and applying the result on page 869 on the text, (b) integrating by parts with u = ln(x + 10), dv = dx, v = x, and Supplementry Questions for HP Chpter 5. Derive the formul ln( + 0) d = ( + 0) ln( + 0) + C in three wys: () by substituting u = + 0 nd pplying the result on pge 869 on the tet, (b) integrting by prts with

More information

Continuous Optimal Timing

Continuous Optimal Timing Srlnd University Computer Science, Srbrücken, Germny My 6, 205 Outline Motivtion Preliminries Existing Algorithms Our Algorithm Empiricl Evlution Conclusion Motivtion Probbilistic models unrelible/unpredictble

More information

Fully Observable. Perfect

Fully Observable. Perfect CS 188: Ar)ficil Intelligence Mrkov Deciion Procee II Stoch)c Plnning: MDP Sttic Environment Fully Obervble Perfect Wht ction next? Stochtic Intntneou Intructor: Dn Klein nd Pieter Abbeel - - - Univerity

More information

Option exercise with temptation

Option exercise with temptation Economic Theory 2008) 34: 473 501 DOI 10.1007/s00199-006-0194-3 RESEARCH ARTICLE Jinjun Mio Option exercise with tempttion Received: 25 Jnury 2006 / Revised: 5 December 2006 / Published online: 10 Jnury

More information

UNIVERSITY OF NOTTINGHAM. Discussion Papers in Economics BERTRAND VS. COURNOT COMPETITION IN ASYMMETRIC DUOPOLY: THE ROLE OF LICENSING

UNIVERSITY OF NOTTINGHAM. Discussion Papers in Economics BERTRAND VS. COURNOT COMPETITION IN ASYMMETRIC DUOPOLY: THE ROLE OF LICENSING UNIVERSITY OF NOTTINGHAM Discussion Ppers in Economics Discussion Pper No. 0/0 BERTRAND VS. COURNOT COMPETITION IN ASYMMETRIC DUOPOLY: THE ROLE OF LICENSING by Arijit Mukherjee April 00 DP 0/0 ISSN 160-48

More information

UNinhabited aerial vehicles (UAVs) are becoming increasingly

UNinhabited aerial vehicles (UAVs) are becoming increasingly A Process Algebr Genetic Algorithm Sertc Krmn Tl Shim Emilio Frzzoli Abstrct A genetic lgorithm tht utilizes process lgebr for coding of solution chromosomes nd for defining evolutionry bsed opertors is

More information

On-demand, Spot, or Both: Dynamic Resource Allocation for Executing Batch Jobs in the Cloud

On-demand, Spot, or Both: Dynamic Resource Allocation for Executing Batch Jobs in the Cloud On-demnd, Spot, or Both: Dynmic Resource Alloction for Executing Btch Jobs in the Cloud Ishi Menche Microsoft Reserch Ohd Shmir Weizmnn Institute Nvendu Jin Microsoft Reserch Abstrct Cloud computing provides

More information

Outline. CSE 326: Data Structures. Priority Queues Leftist Heaps & Skew Heaps. Announcements. New Heap Operation: Merge

Outline. CSE 326: Data Structures. Priority Queues Leftist Heaps & Skew Heaps. Announcements. New Heap Operation: Merge CSE 26: Dt Structures Priority Queues Leftist Heps & Skew Heps Outline Announcements Leftist Heps & Skew Heps Reding: Weiss, Ch. 6 Hl Perkins Spring 2 Lectures 6 & 4//2 4//2 2 Announcements Written HW

More information

Problem Set for Chapter 3: Simple Regression Analysis ECO382 Econometrics Queens College K.Matsuda

Problem Set for Chapter 3: Simple Regression Analysis ECO382 Econometrics Queens College K.Matsuda Problem Set for Chpter 3 Simple Regression Anlysis ECO382 Econometrics Queens College K.Mtsud Excel Assignments You re required to hnd in these Excel Assignments by the due Mtsud specifies. Legibility

More information

3/1/2016. Intermediate Microeconomics W3211. Lecture 7: The Endowment Economy. Today s Aims. The Story So Far. An Endowment Economy.

3/1/2016. Intermediate Microeconomics W3211. Lecture 7: The Endowment Economy. Today s Aims. The Story So Far. An Endowment Economy. 1 Intermedite Microeconomics W3211 Lecture 7: The Endowment Economy Introduction Columbi University, Spring 2016 Mrk Den: mrk.den@columbi.edu 2 The Story So Fr. 3 Tody s Aims 4 Remember: the course hd

More information

Do We Really Need Gaussian Filters for Feature Detection? (Supplementary Material)

Do We Really Need Gaussian Filters for Feature Detection? (Supplementary Material) Do We Relly Need Gussin Filters for Feture Detection? (Supplementry Mteril) Lee-Kng Liu, Stnley H. Chn nd Truong Nguyen Februry 5, 0 This document is supplementry mteril to the pper submitted to EUSIPCO

More information

Menu costs, firm size and price rigidity

Menu costs, firm size and price rigidity Economics Letters 66 (2000) 59 63 www.elsevier.com/ locte/ econbse Menu costs, firm size nd price rigidity Robert A. Buckle *, John A. Crlson, b School of Economics nd Finnce, Victori University of Wellington,

More information

Controlling a population of identical MDP

Controlling a population of identical MDP Controlling popultion of identicl MDP Nthlie Bertrnd Inri Rennes ongoing work with Miheer Dewskr (CMI), Blise Genest (IRISA) nd Hugo Gimert (LBRI) Trends nd Chllenges in Quntittive Verifiction Mysore,

More information

Optimal incentive contracts under loss aversion and inequity aversion

Optimal incentive contracts under loss aversion and inequity aversion Fuzzy Optim Decis Mking https://doi.org/10.1007/s10700-018-9288-1 Optiml incentive contrcts under loss version nd inequity version Chi Zhou 1 Jin Peng 2 Zhibing Liu 2 Binwei Dong 3 Springer Science+Business

More information

Arithmetic and Geometric Sequences

Arithmetic and Geometric Sequences Arithmetic nd Geometric Sequences A sequence is list of numbers or objects, clled terms, in certin order. In n rithmetic sequence, the difference between one term nd the next is lwys the sme. This difference

More information

STAT 472 Fall 2016 Test 2 November 8, 2016

STAT 472 Fall 2016 Test 2 November 8, 2016 STAT 47 Fll 016 Test November 8, 016 1. Anne who is (65) buys whole life policy with deth benefit of 00,000 pyble t the end of the yer of deth. The policy hs nnul premiums pyble for life. The premiums

More information

Optimal firm's policy under lead time- and price-dependent demand: interest of customers rejection policy

Optimal firm's policy under lead time- and price-dependent demand: interest of customers rejection policy Optiml firm's policy under led time- nd price-dependent demnd: interest of customers rejection policy Abduh Syid Albn Université Grenoble Alpes, G-SCOP, F-38000 Grenoble, Frnce bduh-syid.lbn@grenoble-inp.org

More information

A Static Model for Voting on Social Security

A Static Model for Voting on Social Security A Sttic Model for Voting on Socil Security Henning Bohn Deprtment of Economics University of Cliforni t Snt Brbr Snt Brbr, CA 93106, USA; nd CESifo Phone: 1-805-893-4532; Fx: 1-805-893-8830. E-mil: bohn@econ.ucsb.edu

More information

Information Acquisition and Disclosure: the Case of Differentiated Goods Duopoly

Information Acquisition and Disclosure: the Case of Differentiated Goods Duopoly Informtion Acquisition nd Disclosure: the Cse of Differentited Goods Duopoly Snxi Li Jinye Yn Xundong Yin We thnk Dvid Mrtimort, Thoms Mriotti, Ptrick Rey, Wilfried Snd-Zntmn, Frnces Xu nd Yongsheng Xu

More information

ECON 105 Homework 2 KEY Open Economy Macroeconomics Due November 29

ECON 105 Homework 2 KEY Open Economy Macroeconomics Due November 29 Instructions: ECON 105 Homework 2 KEY Open Economy Mcroeconomics Due Novemer 29 The purpose of this ssignment it to integrte the explntions found in chpter 16 ok Kennedy with the D-S model nd the Money

More information

164 CHAPTER 2. VECTOR FUNCTIONS

164 CHAPTER 2. VECTOR FUNCTIONS 164 CHAPTER. VECTOR FUNCTIONS.4 Curvture.4.1 Definitions nd Exmples The notion of curvture mesures how shrply curve bends. We would expect the curvture to be 0 for stright line, to be very smll for curves

More information

This paper is not to be removed from the Examination Halls UNIVERSITY OF LONDON

This paper is not to be removed from the Examination Halls UNIVERSITY OF LONDON ~~FN3092 ZA 0 his pper is not to be remove from the Exmintion Hlls UNIESIY OF LONDON FN3092 ZA BSc egrees n Diploms for Grutes in Economics, Mngement, Finnce n the Socil Sciences, the Diploms in Economics

More information

A portfolio approach to the optimal funding of pensions

A portfolio approach to the optimal funding of pensions Economics Letters 69 (000) 01 06 www.elsevier.com/ locte/ econbse A portfolio pproch to the optiml funding of pensions Jysri Dutt, Sndeep Kpur *, J. Michel Orszg b, b Fculty of Economics University of

More information

On the Complexity of Computing the Justification Status of an Argument

On the Complexity of Computing the Justification Status of an Argument On the Complexity of Computing the Justifiction Sttus of n Argument dbi Reserch Seminr, Vienn Wolfgng Dvořák Institute of Informtion Systems, Vienn University of Technology Oct 13, 2011 Supported by the

More information

Math 205 Elementary Algebra Fall 2010 Final Exam Study Guide

Math 205 Elementary Algebra Fall 2010 Final Exam Study Guide Mth 0 Elementr Algebr Fll 00 Finl Em Stud Guide The em is on Tuesd, December th from :0m :0m. You re llowed scientific clcultor nd " b " inde crd for notes. On our inde crd be sure to write n formuls ou

More information

MIXED OLIGOPOLIES AND THE PROVISION OF DURABLE GOODS. Baranovskyi Volodymyr. MA in Economic Analysis. Kyiv School of Economics

MIXED OLIGOPOLIES AND THE PROVISION OF DURABLE GOODS. Baranovskyi Volodymyr. MA in Economic Analysis. Kyiv School of Economics MIXED OLIGOPOLIES AND THE PROVISION OF DURABLE GOODS by Brnovskyi Volodymyr A thesis submitted in prtil fulfillment of the requirements for the degree of MA in Economic Anlysis Kyiv School of Economics

More information

Complete the table below to show the fixed, variable and total costs. In the final column, calculate the profit or loss made by J Kane.

Complete the table below to show the fixed, variable and total costs. In the final column, calculate the profit or loss made by J Kane. Tsk 1 J Kne sells mchinery to the frm industry. His fixed costs re 10,000 nd ech mchine costs him 400 to buy. He sells them t 600 nd is trying to work out his profit or loss t vrious levels of sles. He

More information

Decision Making Under Uncertainty

Decision Making Under Uncertainty CSC384: Intro to Artificil Intelligence Preferences Decision Mking Under Uncertinty Decision Trees DBN: 15.1 nd 15.5 Decision Network: 16.1,16.2,16.5,16.6 I give root plnning prolem: I wnt coffee ut coffee

More information

Measuring Search Trees

Measuring Search Trees Mesuring Serch Trees Christin Bessiere 1, Bruno Znuttini 2, nd Cèsr Fernández 3 1 LIRMM-CNRS, Montpellier, Frnce 2 GREYC, Cen, Frnce 3 Univ. de Lleid, Lleid, Spin Astrct. The SAT nd CSP communities mke

More information

Technical Report Global Leader Dry Bulk Derivatives. FIS Technical - Grains And Ferts. Highlights:

Technical Report Global Leader Dry Bulk Derivatives. FIS Technical - Grains And Ferts. Highlights: Technicl Report Technicl Anlyst FIS Technicl - Grins And Ferts Edwrd Hutn 44 20 7090 1120 Edwrdh@freightinvesr.com Highlights: SOY The weekly chrt is chowing lower high suggesting wekness going forwrd,

More information

Preference Cloud Theory: Imprecise Preferences and Preference Reversals Oben Bayrak and John Hey

Preference Cloud Theory: Imprecise Preferences and Preference Reversals Oben Bayrak and John Hey Preference Cloud Theory: Imprecise Preferences nd Preference Reversls Oben Byrk nd John Hey This pper presents new theory, clled Preference Cloud Theory, of decision-mking under uncertinty. This new theory

More information

A Closer Look at Bond Risk: Duration

A Closer Look at Bond Risk: Duration W E B E X T E S I O 4C A Closer Look t Bond Risk: Durtion This Extension explins how to mnge the risk of bond portfolio using the concept of durtion. BOD RISK In our discussion of bond vlution in Chpter

More information

Notes on the BENCHOP implementations for the COS method

Notes on the BENCHOP implementations for the COS method Notes on the BENCHOP implementtions for the COS method M. J. uijter C. W. Oosterlee Mrch 29, 2015 Abstrct This text describes the COS method nd its implementtion for the BENCHOP-project. 1 Fourier cosine

More information

production for Community & Culture Project Reference e 2 design episodes Bogotá: Building a Sustainable City and Affordable Green Housing.

production for Community & Culture Project Reference e 2 design episodes Bogotá: Building a Sustainable City and Affordable Green Housing. Community & Culture Project Reference e 2 design episodes Bogotá: Building Sustinble City nd Affordble Green Housing. 1) Red the bckground essy nd discussion questions for e 2 design episodes Bogotá: Building

More information

Buckling of Stiffened Panels 1 overall buckling vs plate buckling PCCB Panel Collapse Combined Buckling

Buckling of Stiffened Panels 1 overall buckling vs plate buckling PCCB Panel Collapse Combined Buckling Buckling of Stiffened Pnels overll uckling vs plte uckling PCCB Pnel Collpse Comined Buckling Vrious estimtes hve een developed to determine the minimum size stiffener to insure the plte uckles while the

More information

Technical Appendix. The Behavior of Growth Mixture Models Under Nonnormality: A Monte Carlo Analysis

Technical Appendix. The Behavior of Growth Mixture Models Under Nonnormality: A Monte Carlo Analysis Monte Crlo Technicl Appendix 1 Technicl Appendix The Behvior of Growth Mixture Models Under Nonnormlity: A Monte Crlo Anlysis Dniel J. Buer & Ptrick J. Currn 10/11/2002 These results re presented s compnion

More information

Asset finance (US) Opportunity. Flexibility. Planning. Develop your capabilities using the latest equipment

Asset finance (US) Opportunity. Flexibility. Planning. Develop your capabilities using the latest equipment Asset finnce (US) Opportunity Develop your cpbilities using the ltest equipment Flexibility Mnge your cshflow nd ccess the technology you need Plnning Mnge your investment with predictble costs nd plnned

More information

Chapter 4. Profit and Bayesian Optimality

Chapter 4. Profit and Bayesian Optimality Chpter 4 Profit nd Byesin Optimlity In this chpter we consider the objective of profit. The objective of profit mximiztion dds significnt new chllenge over the previously considered objective of socil

More information

Pushdown Automata. Courtesy: Costas Busch RPI

Pushdown Automata. Courtesy: Costas Busch RPI Pushdown Automt Courtesy: Costs Busch RPI Pushdown Automt Pushdown Automt Pushdown Automt Pushdown Automt Pushdown Automt Pushdown Automt Non-Determinism:NPDA PDAs re non-deterministic: non-deterministic

More information

arxiv: v1 [cs.lg] 23 Jan 2019

arxiv: v1 [cs.lg] 23 Jan 2019 Robust temporl difference lerning for criticl domins rxiv:1901.08021v1 [cs.lg] 23 Jn 2019 Richrd Klim University of Liverpool, UK richrd.klim@liverpool.c.uk Michel Kisers Centrum Wiskunde & Informtic,

More information

The Market Approach to Valuing Businesses (Second Edition)

The Market Approach to Valuing Businesses (Second Edition) BV: Cse Anlysis Completed Trnsction & Guideline Public Comprble MARKET APPROACH The Mrket Approch to Vluing Businesses (Second Edition) Shnnon P. Prtt This mteril is reproduced from The Mrket Approch to

More information

Optimal Cost Sharing Protocols for Scheduling Games

Optimal Cost Sharing Protocols for Scheduling Games Optiml Cost Shring Protocols for Scheduling Gmes Philipp von Flkenhusen Berlin Institute of Technology Institute of Mthemtics p.flkenhusen@gmil.com Tobis Hrks Berlin Institute of Technology Institute of

More information

Database System Concepts, 5 th Ed. Silberschatz, Korth and Sudarshan See for conditions on re-use

Database System Concepts, 5 th Ed. Silberschatz, Korth and Sudarshan See  for conditions on re-use Chpter 2: Reltionl Model Dtbse System Concepts, 5 th Ed. See www.db-book.com for conditions on re-use Bnking Exmple brnch (brnch_nme, brnch_city, ssets) customer (customer_nme, customer_street, customer_city)

More information

Fractal Analysis on the Stock Price of C to C Electronic Commerce Enterprise Ming Chen

Fractal Analysis on the Stock Price of C to C Electronic Commerce Enterprise Ming Chen 6th Interntionl Conference on Electronic, Mechnicl, Informtion nd Mngement (EMIM 2016) Frctl Anlysis on the Stock Price of C to C Electronic Commerce Enterprise Ming Chen Soochow University, Suzhou, Chin

More information

The Option-Critic Architecture

The Option-Critic Architecture The Option-Critic Architecture Pierre-Luc Bcon nd Jen Hrb nd Doin Precup Resoning nd Lerning Lb, School of Computer Science McGill University {pbcon, jhrb, dprecup}@cs.mcgill.c Preliminries nd Nottion

More information

A ppendix to. I soquants. Producing at Least Cost. Chapter

A ppendix to. I soquants. Producing at Least Cost. Chapter A ppendix to Chpter 0 Producing t est Cost This ppendix descries set of useful tools for studying firm s long-run production nd costs. The tools re isoqunts nd isocost lines. I soqunts FIGURE A0. SHOWS

More information

Technical Report Global Leader Dry Bulk Derivatives. FIS Technical - Grains And Ferts. Highlights:

Technical Report Global Leader Dry Bulk Derivatives. FIS Technical - Grains And Ferts. Highlights: Technicl Report Technicl Anlyst FIS Technicl - Grins And Ferts Edwrd Hutn 442070901120 Edwrdh@freightinvesr.com Client Reltions Andrew Cullen 442070901120 Andrewc@freightinvesr.com Highlights: SOY remins

More information

of Manchester The University START of Manchester The University

of Manchester The University START of Manchester The University /3/0 COMP4 Lecure 8 Hidden Mrkov Models Hidden Mrkov Models Imgine he s nd s re hidden, so he d roduced is sequence of nd D generion is esy, -------- D decoding is miguous,? Ses emi feures or, u heir originis

More information

News Release Half-year Results 20 February Review of results and operations. Excluding significant items a

News Release Half-year Results 20 February Review of results and operations. Excluding significant items a News Relese 2018 Hlf-yer Results 20 Februry 2018 Review of results nd opertions Hlf-yer ended 31 December 2017 Reported Excluding significnt items Vrince to pcp (exc. sig. items) Operting revenue $35.9b

More information

Today s Outline. One More Operation. Priority Queues. New Operation: Merge. Leftist Heaps. Priority Queues. Admin: Priority Queues

Today s Outline. One More Operation. Priority Queues. New Operation: Merge. Leftist Heaps. Priority Queues. Admin: Priority Queues Tody s Outline Priority Queues CSE Dt Structures & Algorithms Ruth Anderson Spring 4// Admin: HW # due this Thursdy / t :9pm Printouts due Fridy in lecture. Priority Queues Leftist Heps Skew Heps 4// One

More information

THE FINAL PROOF SUPPORTING THE TURNOVER FORMULA.

THE FINAL PROOF SUPPORTING THE TURNOVER FORMULA. THE FINAL PROOF SUPPORTING THE TURNOVER FORMULA. I would like to thnk Aris for his mthemticl contriutions nd his swet which hs enled deeper understnding of the turnover formul to emerge. His contriution

More information

Problem Set 4 - Solutions. Suppose when Russia opens to trade, it imports automobiles, a capital-intensive good.

Problem Set 4 - Solutions. Suppose when Russia opens to trade, it imports automobiles, a capital-intensive good. roblem Set 4 - Solutions uestion Suppose when ussi opens to trde, it imports utomobiles, cpitl-intensive good. ) According to the Heckscher-Ohlin theorem, is ussi cpitl bundnt or lbor bundnt? Briefly explin.

More information

Pairwise sequence comparison. Global alignment with linear gap cost

Pairwise sequence comparison. Global alignment with linear gap cost Pirwise sequence comprison Globl linment with liner p cost DNA sequences The humn enome 5 cells, ech contins 3 pirs of chromosomes, DNA molecules, which stores enetic informtion... GGCCTAAAGGCGCCGGTCTT

More information

Tble 1: Syntx of LOTOS/T+ E :: stop (untimed dedlock) j exit (successful termintion) j ; E (ction prex, untimed) j [P (t; x)]; E (ction prex, timed) j

Tble 1: Syntx of LOTOS/T+ E :: stop (untimed dedlock) j exit (successful termintion) j ; E (ction prex, untimed) j [P (t; x)]; E (ction prex, timed) j Protocol Synthesis from Timed nd Structured Specictions Akio Nkt Teruo Higshino Kenichi Tniguchi Dept. of Informtion nd Computer Sciences, Osk University Toyonk, Osk 56, Jpn Abstrct In this pper, we propose

More information

The Combinatorial Seller s Bid Double Auction: An Asymptotically Efficient Market Mechanism*

The Combinatorial Seller s Bid Double Auction: An Asymptotically Efficient Market Mechanism* The Combintoril Seller s Bid Double Auction: An Asymptoticlly Efficient Mret Mechnism* Rhul Jin IBM Wtson Reserch Hwthorne, NY rhul.jin@us.ibm.com Prvin Vriy EECS Deprtment University of Cliforni, Bereley

More information

Behavioural Differential Equations and Coinduction for Binary Trees

Behavioural Differential Equations and Coinduction for Binary Trees Behviourl Differentil Equtions nd Coinduction for Binry Trees Alexndr Silv nd Jn Rutten,2 Centrum voor Wiskunde en Informtic (CWI) 2 Vrije Universiteit Amsterdm (VUA) {ms,jnr}@cwi.nl Abstrct. We study

More information

NORTH YORKSHIRE PENSION FUND GOVERNANCE COMPLIANCE STATEMENT

NORTH YORKSHIRE PENSION FUND GOVERNANCE COMPLIANCE STATEMENT NORTH YORKSHIRE PENSION FUND GOVERNANCE COMPLIANCE STATEMENT TABLE OF CONTENTS Section Pge 1 INTRODUCTION 2 2 GOVERNANCE ARRANGEMENTS 2 3 REPRESENTATION AND MEETINGS 4 4 OPERATIONAL PROCEDRES 5 5 KEY POLICY

More information

1. Detailed information about the Appellant s and Respondent s personal information including mobile no. and -id are to be furnished.

1. Detailed information about the Appellant s and Respondent s personal information including mobile no. and  -id are to be furnished. Revised Form 36 nd Form 36A for filing ppel nd cross objection respectively before income tx ppellte tribunl (Notifiction No. 72 dted 23.10.2018) Bckground CBDT issued drft notifiction vide press relese

More information

PSAS: Government transfers what you need to know

PSAS: Government transfers what you need to know PSAS: Government trnsfers wht you need to know Ferury 2018 Overview This summry will provide users with n understnding of the significnt recognition, presenttion nd disclosure requirements of the stndrd.

More information

Technical Report Global Leader Dry Bulk Derivatives. FIS Technical - Grains And Ferts. Highlights:

Technical Report Global Leader Dry Bulk Derivatives. FIS Technical - Grains And Ferts. Highlights: Technicl Report Technicl Anlyst FIS Technicl - Grins And Ferts Edwrd Hutn 44 20 7090 1120 Edwrdh@freightinvesr.com Highlights: SOY The weekly schstic is wrning slowing momentum in the mrket. USD 966 ¼

More information

FINANCIAL ANALYSIS I. INTRODUCTION AND METHODOLOGY

FINANCIAL ANALYSIS I. INTRODUCTION AND METHODOLOGY Dhk Wter Supply Network Improvement Project (RRP BAN 47254003) FINANCIAL ANALYSIS I. INTRODUCTION AND METHODOLOGY A. Introduction 1. The Asin Development Bnk (ADB) finncil nlysis of the proposed Dhk Wter

More information

No. 27 / October Ebert, Michael / Kadane, Joseph B. / Simons, Dirk / Stecher, Jack D. Disclosure and Rollover Risk

No. 27 / October Ebert, Michael / Kadane, Joseph B. / Simons, Dirk / Stecher, Jack D. Disclosure and Rollover Risk No. 27 / October 2017 Ebert, Michel / Kdne, Joseph B. / Simons, Dirk / Stecher, Jck D. Disclosure nd Rollover Risk Disclosure nd Rollover Risk Michel Ebert 1 Joseph B. Kdne 2 Dirk Simons 3 Jck D. Stecher

More information

Optimal Redistributive Taxation in a Search Equilibrium Model.

Optimal Redistributive Taxation in a Search Equilibrium Model. Optiml Redistributive Txtion in Serch Equilibrium Model. Mthis HUNGERBÜHLER mthis.hungerbuhler@fundp.c.be Alexis PARMENTIER cdb prment@univ-pris1.fr November 16, 2005 Etienne LEHMANN bce elehmnn@u-pris2.fr

More information

Effects of Entry Restriction on Free Entry General Competitive Equilibrium. Mitsuo Takase

Effects of Entry Restriction on Free Entry General Competitive Equilibrium. Mitsuo Takase CAES Working Pper Series Effects of Entry Restriction on Free Entry Generl Competitive Euilirium Mitsuo Tkse Fculty of Economics Fukuok University WP-2018-006 Center for Advnced Economic Study Fukuok University

More information

Insurance: Mathematics and Economics

Insurance: Mathematics and Economics Insurnce: Mthemtics nd Economics 43 008) 303 315 Contents lists vilble t ScienceDirect Insurnce: Mthemtics nd Economics journl homepge: www.elsevier.com/locte/ime he design of equity-indexed nnuities Phelim

More information

This paper is not to be removed from the Examination Halls

This paper is not to be removed from the Examination Halls This pper is not to be remove from the Exmintion Hlls UNIVESITY OF LONON FN3092 ZB (279 0092) BSc egrees n iploms for Grutes in Economics, Mngement, Finnce n the Socil Sciences, the iploms in Economics

More information

Bequest motives and fertility decisions B

Bequest motives and fertility decisions B Economics Letters 92 (2006) 348 352 www.elsevier.com/locte/econbse Bequest motives nd fertility decisions B Ritsuko Futgmi, Kimiyoshi Kmd b, *, Tkshi Sto c Deprtment of Mngement Informtion Systems, Chubu

More information