Chapter 3: The Reinforcement Learning Problem. The Agent'Environment Interface. Getting the Degree of Abstraction Right. The Agent Learns a Policy

Size: px
Start display at page:

Download "Chapter 3: The Reinforcement Learning Problem. The Agent'Environment Interface. Getting the Degree of Abstraction Right. The Agent Learns a Policy"

Transcription

1 Chpter 3: The Reinforcement Lerning Problem The Agent'Environment Interfce Objectives of this chpter: describe the RL problem we will be studying for the reminder of the course present idelized form of the RL problem for which we hve precise theoreticl results; introduce key components of the mthemtics: vlue functions nd Bellmn equtions; Agent nd environment interct t discrete time steps Agent observes stte t step t :!S produces ction t step t : t! A( ) gets resulting rewrd : r t +1! : t = 0, 1, 2, K describe trde'os between pplicbility nd mthemticl trctbility.... nd resulting next stte : +1 r t +1 s t +1 t +1 t r t +2 s r t +3 t +2 st t +2 t The Agent Lerns Policy Policy t step t,! t : mpping from stteo ction probbilities! t (s, ) = probbility tht t = when Reinforcement lerning methods specify how the gent chnges its policy s result of experience. Roughly, the gent(s gol io get s much rewrd s it cn over the long run. Getting the Degree of Abstrction Right Time steps need not refer to!xed intervls of rel time. Actions cn be low level e.g., voltgeo motors, or high level e.g., ccept job oer, %mentl& e.g., shift in focus of ttention, etc. Sttes cn be low'level %senstions&, or they cn be bstrct, symbolic, bsed on memory, or subjective e.g., the stte of being %surprised& or %lost&. An RL gent is not like whole niml or robot, which consist of mny RL gents s well s other components. The environment is not necessrily unknown to the gent, only incompletely controllble. 3 3 Rewrd computtion is in the gent(s environment becuse the gent cnnot chnge it rbitrrily. 4 4

2 Gols nd Rewrds Returns Is sclr rewrd signl n dequte notion of gol?) mybe not, but it is surprisingly *exible. Suppose the sequence of rewrds fter step t is : r t +1, r t+ 2, r t + 3, K Wht do we wnt to mximize? A gol should specify wht we wnt to chieve, not how we wnt to chieve it. A gol must be outside the gent(s direct control)thus outside the gent. The gent must be ble to mesure success: In generl, we wnt to mximize the expected return, E{ }, for ech step t. Episodic tsks: interction breks nturlly into episodes, e.g., plys of gme, triphrough mze. + r t +2 +L + r T, explicitly; frequently during its life'spn. where T is!nl time step t which terminl stte is reched, ending n episode Returns for Continuing Tsks An Exmple Continuing tsks: interction does not hve nturl episodes. Discounted return: +! r t+ 2 +! 2 r t +3 +L =! k r t + k +1, k =0 where!, 0! 1, ihe discount rte. shortsighted 0! 1 frsighted Avoid filure: the pole flling beyond criticl ngle or the crt hitting end of trck. As n episodic tsk where episode ends upon filure: rewrd = +1 for ech step before filure! return = number of steps before filure As continuing tsk with discounted return: rewrd =!1 upon filure; 0 otherwise return is relted to! k, for k steps before filure In either cse, return is mximized by voiding filure for s long s possible

3 Another Exmple Get to the top of the hill s quickly s possible. A Uni!ed Nottion In episodic tsks, we number the time steps of ech episode strting from zero. We usully do not hve to distinguish between episodes, so we write insted of for the stte t step t of episode j., j Think of ech episode s ending in n bsorbing stte tht lwys produces rewrd of zero: rewrd =!1 for ech step where not t top of hill return =! number of steps before reching top of hill Return is mximized by minimizing number of steps rech the top of the hill. We cn cover ll cses by writing =! k r t +k +1, where! cn be 1 only if zero rewrd bsorbing stte is lwys reched. k = The Mrkov Property Mrkov Decision Processes By %the stte& t step t, the book mens whtever informtion is vilble to the gent t step t bout its environment. The stte cn include immedite %senstions,& highly processed senstions, nd structures built up over time from sequences of senstions. Idelly, stte should summrize pst senstions so o retin ll %essentil& informtion, i.e., it should hve the Mrkov Property: If reinforcement lerning tsk hhe Mrkov Property, it is bsiclly Mrkov Decision Process (MDP). If stte nd ction sets re!nite, it is finite MDP. To de!ne!nite MDP, you need to give: stte nd ction sets one'step %dynmics& de!ned by trnsition probbilities = Pr{ +1!, r t +1 = r, t } Pr +1!, r t +1 = r, t,r t, 1, t 1,K, r 1,s 0, 0 for ll s!, r, nd histories, t,r t, 1, t 1,K, r 1, s 0, P s s! = Pr +1!, t = rewrd expecttions: R s! for ll s,! for ll s,! = E r t +1, t =, +1! 12 s S, A(s). s S, A(s). 12

4 An Exmple Finite MDP Recycling Robot MDP Recycling Robot At ech step, robot ho decide whether it should 1 ctively serch for cn, 2 wit for someone to bring it cn, or 3 go to home bse nd rechrge. Serching is better but runs down the bttery; if runs out of power while serching, ho be rescued which is bd. Decisions mde on bsis of current energy level: high, low. S = { high, low} A(high) = { serch, wit} A(low) = { serch, wit, rechrge } R serch = expected no. of cns while serching R wit = expected no. of cns while witing R serch > R wit Vlue Functions Bellmn Eqution for Policy! The vlue of stte ihe expected return strting from tht stte; depends on the gent(s policy: Stte - vlue function for policy! : = E! & k r t +k +1 V! (s) = E! % ' k =0 ( ) * The bsic ide: +! r t +2 +! 2 r t + 3 +! 3 r t + 4 L +! r t +2 +! r t +3 +! 2 r t + 4 L +! +1 ( ) The vlue of tking n ction in stte under policy! ihe expected return strting from tht stte, tking tht ction, nd therefter following! : So: V! (s) = E! = E! r t +1 + V! ( +1 ) Action- vlue function for policy! : = E! & k r t + k +1, t = Q! (s, ) = E!, t = % ' k = 0 ( ) * Or, without the expecttion opertor: V! (s) =!(s, ) P s s s [ R s s + V! ( s )]

5 More on the Bellmn Eqution V! (s) =!(s, ) P s s s [ R s s + V! ( s )] This is set of equtions in fct, liner, one for ech stte. The vlue function for! is its unique solution. Bckup digrms: Gridworld Actions: north, south, est, west; deterministic. If would tke gent o the grid: no move but rewrd = +1 Other ctions produce rewrd = 0, except ctionht move gent out of specil sttes A nd B s shown. Stte'vlue function for equiprobble rndom policy; = 0.9 for V! for Q! Stte is bll loction Rewrd of +1 for ech stroke until the bll is in the hole Vlue of stte? Actions: putt use putter driver use driver putt succeeds nywhere on the green Golf Optiml Vlue Functions For!nite MDPs, policies cn be prtilly ordered:!! if nd only if V! (s) V! (s) for ll s S There is lwys t lest one nd possibly mny policieht is better thn or equl to ll the others. This is n optiml policy. We denote them ll! *. Optiml policies shre the sme optiml stte-vlue function: V! (s) = mx V (s) for ll s S Optiml policies lso shre the sme optiml ction-vlue function: Q! (s, ) = mx Q (s, ) for ll s S nd A(s) This ihe expected return for tking ction in stte s nd therefter following n optiml policy

6 Optiml Vlue Function for Golf We cn hit the bll frther with driver thn with putter, but with less ccurcy Q*s,driver givehe vlue or using driver!rst, then using whichever ctions re best Bellmn Optimlity Eqution for V* The vlue of stte under n optiml policy must equl the expected return for the best ction from tht stte: V!! (s) = mx A( s) Q (s,) = mx E r t +1 + V! ( +1 ), t = A( s) = mx & P s s % [ R s s % + V! ( s %)] A( s) s % The relevnt bckup digrm: V! ihe unique solution of this system of nonliner equtions Bellmn Optimlity Eqution for Q* s [ R s s + mx Q! ( s, ) ] Q! (s, ) = E r t +1 + mx Q! ( s, ), t = = P s s Why Optiml Stte'Vlue Functions re Useful Any policy tht is greedy with respect to V! Therefore, given, one'step'hed serch producehe long'term optiml ctions. E.g., bck to the gridworld: V! is n optiml policy. The relevnt bckup digrm: Q * ihe unique solution of this system of nonliner equtions

7 Wht About Optiml Action'Vlue Functions? Q * Given, the gent does not even hve to do one'step' hed serch:! (s) = rg mx A(s) Q (s, ) Solving the Bellmn Optimlity Eqution Finding n optiml policy by solving the Bellmn Optimlity Eqution requirehe following: ccurte knowledge of environment dynmics; we hve enough spce nd time to do the computtion; the Mrkov Property. How much spce nd time do we need? polynomil in number of sttes vi dynmic progrmming methods; Chpter 4, BUT, number of sttes is often huge e.g., bckgmmon hs bout 10**20 sttes. We usully hve to settle for pproximtions. Mny RL methods cn be understood s pproximtely solving the Bellmn Optimlity Eqution Summry Agent'environment interction Sttes Actions Rewrds Policy: stochstic rule for selecting ctions Return: the function of future rewrds gent trieo mximize Episodic nd continuing tsks Mrkov Property Mrkov Decision Process Trnsition probbilities Expected rewrds Vlue functions Stte'vlue function for policy Action'vlue function for policy Optiml stte'vlue function Optiml ction'vlue function Optiml vlue functions Optiml policies Bellmn Equtions The need for pproximtion 27 27

Reinforcement Learning. CS 188: Artificial Intelligence Fall Grid World. Markov Decision Processes. What is Markov about MDPs?

Reinforcement Learning. CS 188: Artificial Intelligence Fall Grid World. Markov Decision Processes. What is Markov about MDPs? CS 188: Artificil Intelligence Fll 2010 Lecture 9: MDP 9/2/2010 Reinforcement Lerning [DEMOS] Bic ide: Receive feedbck in the form of rewrd Agent utility i defined by the rewrd function Mut (lern to) ct

More information

3: Inventory management

3: Inventory management INSE6300 Ji Yun Yu 3: Inventory mngement Concordi Februry 9, 2016 Supply chin mngement is bout mking sequence of decisions over sequence of time steps, fter mking observtions t ech of these time steps.

More information

Gridworld Values V* Gridworld: Q*

Gridworld Values V* Gridworld: Q* CS 188: Artificil Intelligence Mrkov Deciion Procee II Intructor: Dn Klein nd Pieter Abbeel --- Univerity of Cliforni, Berkeley [Thee lide were creted by Dn Klein nd Pieter Abbeel for CS188 Intro to AI

More information

Outline. CS 188: Artificial Intelligence Spring Speeding Up Game Tree Search. Minimax Example. Alpha-Beta Pruning. Pruning

Outline. CS 188: Artificial Intelligence Spring Speeding Up Game Tree Search. Minimax Example. Alpha-Beta Pruning. Pruning CS 188: Artificil Intelligence Spring 2011 Lecture 8: Gme, MDP 2/14/2010 Pieter Abbeel UC Berkeley Mny lide dpted from Dn Klein Outline Zero-um determinitic two plyer gme Minimx Evlution function for non-terminl

More information

DYNAMIC PROGRAMMING REINFORCEMENT LEARNING. COGS 202 : Week 7 Presentation

DYNAMIC PROGRAMMING REINFORCEMENT LEARNING. COGS 202 : Week 7 Presentation DYNAMIC PROGRAMMING REINFORCEMENT LEARNING COGS 202 : Week 7 Preenttion OUTLINE Recp (Stte Vlue nd Action Vlue function) Computtion in MDP Dynmic Progrmming (DP) Policy Evlution Policy Improvement Policy

More information

Non-Deterministic Search. CS 188: Artificial Intelligence Markov Decision Processes. Grid World Actions. Example: Grid World

Non-Deterministic Search. CS 188: Artificial Intelligence Markov Decision Processes. Grid World Actions. Example: Grid World CS 188: Artificil Intelligence Mrkov Deciion Procee Non-Determinitic Serch Dn Klein, Pieter Abbeel Univerity of Cliforni, Berkeley Exmple: Grid World Grid World Action A mze-like problem The gent live

More information

Announcements. CS 188: Artificial Intelligence Fall Recap: MDPs. Recap: Optimal Utilities. Practice: Computing Actions. Recap: Bellman Equations

Announcements. CS 188: Artificial Intelligence Fall Recap: MDPs. Recap: Optimal Utilities. Practice: Computing Actions. Recap: Bellman Equations CS 188: Artificil Intelligence Fll 2009 Lecture 10: MDP 9/29/2009 Announcement P2: Due Wednedy P3: MDP nd Reinforcement Lerning i up! W2: Out lte thi week Dn Klein UC Berkeley Mny lide over the coure dpted

More information

Recap: MDPs. CS 188: Artificial Intelligence Fall Optimal Utilities. The Bellman Equations. Value Estimates. Practice: Computing Actions

Recap: MDPs. CS 188: Artificial Intelligence Fall Optimal Utilities. The Bellman Equations. Value Estimates. Practice: Computing Actions CS 188: Artificil Intelligence Fll 2008 Lecture 10: MDP 9/30/2008 Dn Klein UC Berkeley Recp: MDP Mrkov deciion procee: Stte S Action A Trnition P(,) (or T(,, )) Rewrd R(,, ) (nd dicount γ) Strt tte 0 Quntitie:

More information

Static Fully Observable Stochastic What action next? Instantaneous Perfect

Static Fully Observable Stochastic What action next?  Instantaneous Perfect CS 188: Ar)ficil Intelligence Mrkov Deciion Procee K+1 Intructor: Dn Klein nd Pieter Abbeel - - - Univerity of Cliforni, Berkeley [Thee lide were creted by Dn Klein nd Pieter Abbeel for CS188 Intro to

More information

Announcements. CS 188: Artificial Intelligence Fall Reinforcement Learning. Markov Decision Processes. Example Optimal Policies.

Announcements. CS 188: Artificial Intelligence Fall Reinforcement Learning. Markov Decision Processes. Example Optimal Policies. CS 188: Artificil Intelligence Fll 2008 Lecture 9: MDP 9/25/2008 Announcement Homework olution / review eion: Mondy 9/29, 7-9pm in 2050 Vlley LSB Tuedy 9/0, 6-8pm in 10 Evn Check web for detil Cover W1-2,

More information

4/30/2012. Overview. MDPs. Planning Agent. Grid World. Review: Expectimax. Introduction & Agents Search, Heuristics & CSPs Adversarial Search

4/30/2012. Overview. MDPs. Planning Agent. Grid World. Review: Expectimax. Introduction & Agents Search, Heuristics & CSPs Adversarial Search Overview CSE 473 Mrkov Deciion Procee Dn Weld Mny lide from Chri Bihop, Mum, Dn Klein, Sturt Ruell, Andrew Moore & Luke Zettlemoyer Introduction & Agent Serch, Heuritic & CSP Adverril Serch Logicl Knowledge

More information

CS 188 Introduction to Artificial Intelligence Fall 2018 Note 4

CS 188 Introduction to Artificial Intelligence Fall 2018 Note 4 CS 188 Introduction to Artificil Intelligence Fll 2018 Note 4 These lecture notes re hevily bsed on notes originlly written by Nikhil Shrm. Non-Deterministic Serch Picture runner, coming to the end of

More information

Multi-Step Reinforcement Learning: A Unifying Algorithm

Multi-Step Reinforcement Learning: A Unifying Algorithm Multi-Step Reinforcement Lerning: A Unifying Algorithm Kristopher De Asis, 1 J. Fernndo Hernndez-Grci, 1 G. Zchris Hollnd, 1 Richrd S. Sutton Reinforcement Lerning nd Artificil Intelligence Lbortory, University

More information

Addition and Subtraction

Addition and Subtraction Addition nd Subtrction Nme: Dte: Definition: rtionl expression A rtionl expression is n lgebric expression in frction form, with polynomils in the numertor nd denomintor such tht t lest one vrible ppers

More information

CS 461: Machine Learning Lecture 8

CS 461: Machine Learning Lecture 8 CS 461: Machine Learning Lecture 8 Dr. Kiri Wagstaff kiri.wagstaff@calstatela.edu 2/23/08 CS 461, Winter 2008 1 Plan for Today Review Clustering Reinforcement Learning How different from supervised, unsupervised?

More information

Cache CPI and DFAs and NFAs. CS230 Tutorial 10

Cache CPI and DFAs and NFAs. CS230 Tutorial 10 Cche CPI nd DFAs nd NFAs CS230 Tutoril 10 Multi-Level Cche: Clculting CPI When memory ccess is ttempted, wht re the possible results? ccess miss miss CPU L1 Cche L2 Cche Memory L1 cche hit L2 cche hit

More information

Controlling a population of identical MDP

Controlling a population of identical MDP Controlling popultion of identicl MDP Nthlie Bertrnd Inri Rennes ongoing work with Miheer Dewskr (CMI), Blise Genest (IRISA) nd Hugo Gimert (LBRI) Trends nd Chllenges in Quntittive Verifiction Mysore,

More information

Maximum Expected Utility. CS 188: Artificial Intelligence Fall Preferences. MEU Principle. Rational Preferences. Utilities: Uncertain Outcomes

Maximum Expected Utility. CS 188: Artificial Intelligence Fall Preferences. MEU Principle. Rational Preferences. Utilities: Uncertain Outcomes CS 188: Artificil Intelligence Fll 2011 Mximum Expected Utility Why hould we verge utilitie? Why not minimx? Lecture 8: Utilitie / MDP 9/20/2011 Dn Klein UC Berkeley Principle of mximum expected utility:

More information

What is Monte Carlo Simulation? Monte Carlo Simulation

What is Monte Carlo Simulation? Monte Carlo Simulation Wht is Monte Crlo Simultion? Monte Crlo methods re widely used clss of computtionl lgorithms for simulting the ehvior of vrious physicl nd mthemticl systems, nd for other computtions. Monte Crlo lgorithm

More information

Fully Observable. Perfect

Fully Observable. Perfect CS 188: Ar)ficil Intelligence Mrkov Deciion Procee II Stoch)c Plnning: MDP Sttic Environment Fully Obervble Perfect Wht ction next? Stochtic Intntneou Intructor: Dn Klein nd Pieter Abbeel - - - Univerity

More information

A Closer Look at Bond Risk: Duration

A Closer Look at Bond Risk: Duration W E B E X T E S I O 4C A Closer Look t Bond Risk: Durtion This Extension explins how to mnge the risk of bond portfolio using the concept of durtion. BOD RISK In our discussion of bond vlution in Chpter

More information

Announcements. Maximizing Expected Utility. Preferences. Rational Preferences. Rational Preferences. Introduction to Artificial Intelligence

Announcements. Maximizing Expected Utility. Preferences. Rational Preferences. Rational Preferences. Introduction to Artificial Intelligence Introduction to Artificil Intelligence V22.0472-001 Fll 2009 Lecture 8: Utilitie Announcement Will hve Aignment 1 grded by Wed. Aignment 2 i up on webpge Due on Mon 19 th October (2 week) Rob Fergu Dept

More information

A ppendix to. I soquants. Producing at Least Cost. Chapter

A ppendix to. I soquants. Producing at Least Cost. Chapter A ppendix to Chpter 0 Producing t est Cost This ppendix descries set of useful tools for studying firm s long-run production nd costs. The tools re isoqunts nd isocost lines. I soqunts FIGURE A0. SHOWS

More information

UNIT 7 SINGLE SAMPLING PLANS

UNIT 7 SINGLE SAMPLING PLANS UNIT 7 SINGLE SAMPLING PLANS Structure 7. Introduction Objectives 7. Single Smpling Pln 7.3 Operting Chrcteristics (OC) Curve 7.4 Producer s Risk nd Consumer s Risk 7.5 Averge Outgoing Qulity (AOQ) 7.6

More information

Intro to Reinforcement Learning. Part 3: Core Theory

Intro to Reinforcement Learning. Part 3: Core Theory Intro to Reinforcement Learning Part 3: Core Theory Interactive Example: You are the algorithm! Finite Markov decision processes (finite MDPs) dynamics p p p Experience: S 0 A 0 R 1 S 1 A 1 R 2 S 2 A 2

More information

A Fuzzy Inventory Model With Lot Size Dependent Carrying / Holding Cost

A Fuzzy Inventory Model With Lot Size Dependent Carrying / Holding Cost IOSR Journl of Mthemtics (IOSR-JM e-issn: 78-578,p-ISSN: 9-765X, Volume 7, Issue 6 (Sep. - Oct. 0, PP 06-0 www.iosrournls.org A Fuzzy Inventory Model With Lot Size Dependent Crrying / olding Cost P. Prvthi,

More information

MARKET POWER AND MISREPRESENTATION

MARKET POWER AND MISREPRESENTATION MARKET POWER AND MISREPRESENTATION MICROECONOMICS Principles nd Anlysis Frnk Cowell Note: the detil in slides mrked * cn only e seen if you run the slideshow July 2017 1 Introduction Presenttion concerns

More information

3/1/2016. Intermediate Microeconomics W3211. Lecture 7: The Endowment Economy. Today s Aims. The Story So Far. An Endowment Economy.

3/1/2016. Intermediate Microeconomics W3211. Lecture 7: The Endowment Economy. Today s Aims. The Story So Far. An Endowment Economy. 1 Intermedite Microeconomics W3211 Lecture 7: The Endowment Economy Introduction Columbi University, Spring 2016 Mrk Den: mrk.den@columbi.edu 2 The Story So Fr. 3 Tody s Aims 4 Remember: the course hd

More information

INF 4130 Exercise set 4

INF 4130 Exercise set 4 INF 4130 Exercise set 4 Exercise 1 List the order in which we extrct the nodes from the Live Set queue when we do redth first serch of the following grph (tree) with the Live Set implemented s LIFO queue.

More information

JFE Online Appendix: The QUAD Method

JFE Online Appendix: The QUAD Method JFE Online Appendix: The QUAD Method Prt of the QUAD technique is the use of qudrture for numericl solution of option pricing problems. Andricopoulos et l. (00, 007 use qudrture s the only computtionl

More information

Chapter 4. Profit and Bayesian Optimality

Chapter 4. Profit and Bayesian Optimality Chpter 4 Profit nd Byesin Optimlity In this chpter we consider the objective of profit. The objective of profit mximiztion dds significnt new chllenge over the previously considered objective of socil

More information

Research Article Existence of Positive Solution to Second-Order Three-Point BVPs on Time Scales

Research Article Existence of Positive Solution to Second-Order Three-Point BVPs on Time Scales Hindwi Publishing Corportion Boundry Vlue Problems Volume 2009, Article ID 685040, 6 pges doi:10.1155/2009/685040 Reserch Article Existence of Positive Solution to Second-Order hree-point BVPs on ime Scles

More information

CH 71 COMPLETING THE SQUARE INTRODUCTION FACTORING PERFECT SQUARE TRINOMIALS

CH 71 COMPLETING THE SQUARE INTRODUCTION FACTORING PERFECT SQUARE TRINOMIALS CH 7 COMPLETING THE SQUARE INTRODUCTION I t s now time to py our dues regrding the Qudrtic Formul. Wht, you my sk, does this men? It mens tht the formul ws merely given to you once or twice in this course,

More information

Smart Investment Strategies

Smart Investment Strategies Smrt Investment Strtegies Risk-Rewrd Rewrd Strtegy Quntifying Greed How to mke good Portfolio? Entrnce-Exit Exit Strtegy: When to buy? When to sell? 2 Risk vs.. Rewrd Strtegy here is certin mount of risk

More information

Continuous Optimal Timing

Continuous Optimal Timing Srlnd University Computer Science, Srbrücken, Germny My 6, 205 Outline Motivtion Preliminries Existing Algorithms Our Algorithm Empiricl Evlution Conclusion Motivtion Probbilistic models unrelible/unpredictble

More information

164 CHAPTER 2. VECTOR FUNCTIONS

164 CHAPTER 2. VECTOR FUNCTIONS 164 CHAPTER. VECTOR FUNCTIONS.4 Curvture.4.1 Definitions nd Exmples The notion of curvture mesures how shrply curve bends. We would expect the curvture to be 0 for stright line, to be very smll for curves

More information

The Market Approach to Valuing Businesses (Second Edition)

The Market Approach to Valuing Businesses (Second Edition) BV: Cse Anlysis Completed Trnsction & Guideline Public Comprble MARKET APPROACH The Mrket Approch to Vluing Businesses (Second Edition) Shnnon P. Prtt This mteril is reproduced from The Mrket Approch to

More information

)''/?\Xck_

)''/?\Xck_ bcbsnc.com Deductible options: $250, $500, $1,000 or $2,500 Deductible options $500, $1,000, $2,500, $3,500 or $5,000 D or (100% coinsurnce is not vilble on the $2,500 deductible option) coinsurnce plns:

More information

arxiv: v1 [cs.lg] 23 Jan 2019

arxiv: v1 [cs.lg] 23 Jan 2019 Robust temporl difference lerning for criticl domins rxiv:1901.08021v1 [cs.lg] 23 Jn 2019 Richrd Klim University of Liverpool, UK richrd.klim@liverpool.c.uk Michel Kisers Centrum Wiskunde & Informtic,

More information

A portfolio approach to the optimal funding of pensions

A portfolio approach to the optimal funding of pensions Economics Letters 69 (000) 01 06 www.elsevier.com/ locte/ econbse A portfolio pproch to the optiml funding of pensions Jysri Dutt, Sndeep Kpur *, J. Michel Orszg b, b Fculty of Economics University of

More information

Problem Set for Chapter 3: Simple Regression Analysis ECO382 Econometrics Queens College K.Matsuda

Problem Set for Chapter 3: Simple Regression Analysis ECO382 Econometrics Queens College K.Matsuda Problem Set for Chpter 3 Simple Regression Anlysis ECO382 Econometrics Queens College K.Mtsud Excel Assignments You re required to hnd in these Excel Assignments by the due Mtsud specifies. Legibility

More information

UNIVERSITY OF NOTTINGHAM. Discussion Papers in Economics BERTRAND VS. COURNOT COMPETITION IN ASYMMETRIC DUOPOLY: THE ROLE OF LICENSING

UNIVERSITY OF NOTTINGHAM. Discussion Papers in Economics BERTRAND VS. COURNOT COMPETITION IN ASYMMETRIC DUOPOLY: THE ROLE OF LICENSING UNIVERSITY OF NOTTINGHAM Discussion Ppers in Economics Discussion Pper No. 0/0 BERTRAND VS. COURNOT COMPETITION IN ASYMMETRIC DUOPOLY: THE ROLE OF LICENSING by Arijit Mukherjee April 00 DP 0/0 ISSN 160-48

More information

Option exercise with temptation

Option exercise with temptation Economic Theory 2008) 34: 473 501 DOI 10.1007/s00199-006-0194-3 RESEARCH ARTICLE Jinjun Mio Option exercise with tempttion Received: 25 Jnury 2006 / Revised: 5 December 2006 / Published online: 10 Jnury

More information

THE FINAL PROOF SUPPORTING THE TURNOVER FORMULA.

THE FINAL PROOF SUPPORTING THE TURNOVER FORMULA. THE FINAL PROOF SUPPORTING THE TURNOVER FORMULA. I would like to thnk Aris for his mthemticl contriutions nd his swet which hs enled deeper understnding of the turnover formul to emerge. His contriution

More information

Roadmap of This Lecture

Roadmap of This Lecture Reltionl Model Rodmp of This Lecture Structure of Reltionl Dtbses Fundmentl Reltionl-Algebr-Opertions Additionl Reltionl-Algebr-Opertions Extended Reltionl-Algebr-Opertions Null Vlues Modifiction of the

More information

Arithmetic and Geometric Sequences

Arithmetic and Geometric Sequences Arithmetic nd Geometric Sequences A sequence is list of numbers or objects, clled terms, in certin order. In n rithmetic sequence, the difference between one term nd the next is lwys the sme. This difference

More information

The Option-Critic Architecture

The Option-Critic Architecture The Option-Critic Architecture Pierre-Luc Bcon nd Jen Hrb nd Doin Precup Resoning nd Lerning Lb, School of Computer Science McGill University {pbcon, jhrb, dprecup}@cs.mcgill.c Preliminries nd Nottion

More information

9.3. Regular Languages

9.3. Regular Languages 9.3. REGULAR LANGUAGES 139 9.3. Regulr Lnguges 9.3.1. Properties of Regulr Lnguges. Recll tht regulr lnguge is the lnguge ssocited to regulr grmmr, i.e., grmmr G = (N, T, P, σ) in which every production

More information

The Okun curve is non-linear

The Okun curve is non-linear Economics Letters 70 (00) 53 57 www.elsevier.com/ locte/ econbse The Okun curve is non-liner Mtti Viren * Deprtment of Economics, 004 University of Turku, Turku, Finlnd Received 5 My 999; ccepted 0 April

More information

The Combinatorial Seller s Bid Double Auction: An Asymptotically Efficient Market Mechanism*

The Combinatorial Seller s Bid Double Auction: An Asymptotically Efficient Market Mechanism* The Combintoril Seller s Bid Double Auction: An Asymptoticlly Efficient Mret Mechnism* Rhul Jin IBM Wtson Reserch Hwthorne, NY rhul.jin@us.ibm.com Prvin Vriy EECS Deprtment University of Cliforni, Bereley

More information

Chapter 2: Relational Model. Chapter 2: Relational Model

Chapter 2: Relational Model. Chapter 2: Relational Model Chpter : Reltionl Model Dtbse System Concepts, 5 th Ed. See www.db-book.com for conditions on re-use Chpter : Reltionl Model Structure of Reltionl Dtbses Fundmentl Reltionl-Algebr-Opertions Additionl Reltionl-Algebr-Opertions

More information

Problem Set 4 - Solutions. Suppose when Russia opens to trade, it imports automobiles, a capital-intensive good.

Problem Set 4 - Solutions. Suppose when Russia opens to trade, it imports automobiles, a capital-intensive good. roblem Set 4 - Solutions uestion Suppose when ussi opens to trde, it imports utomobiles, cpitl-intensive good. ) According to the Heckscher-Ohlin theorem, is ussi cpitl bundnt or lbor bundnt? Briefly explin.

More information

Lecture 12: MDP1. Victor R. Lesser. CMPSCI 683 Fall 2010

Lecture 12: MDP1. Victor R. Lesser. CMPSCI 683 Fall 2010 Lecture 12: MDP1 Victor R. Lesser CMPSCI 683 Fall 2010 Biased Random GSAT - WalkSat Notice no random restart 2 Today s lecture Search where there is Uncertainty in Operator Outcome --Sequential Decision

More information

(a) by substituting u = x + 10 and applying the result on page 869 on the text, (b) integrating by parts with u = ln(x + 10), dv = dx, v = x, and

(a) by substituting u = x + 10 and applying the result on page 869 on the text, (b) integrating by parts with u = ln(x + 10), dv = dx, v = x, and Supplementry Questions for HP Chpter 5. Derive the formul ln( + 0) d = ( + 0) ln( + 0) + C in three wys: () by substituting u = + 0 nd pplying the result on pge 869 on the tet, (b) integrting by prts with

More information

ECON 105 Homework 2 KEY Open Economy Macroeconomics Due November 29

ECON 105 Homework 2 KEY Open Economy Macroeconomics Due November 29 Instructions: ECON 105 Homework 2 KEY Open Economy Mcroeconomics Due Novemer 29 The purpose of this ssignment it to integrte the explntions found in chpter 16 ok Kennedy with the D-S model nd the Money

More information

Exhibit A Covered Employee Notification of Rights Materials Regarding Allied Managed Care Incorporated Allied Managed Care MPN MPN ID # 2360

Exhibit A Covered Employee Notification of Rights Materials Regarding Allied Managed Care Incorporated Allied Managed Care MPN MPN ID # 2360 Covered Notifiction of Rights Mterils Regrding Allied Mnged Cre Incorported Allied Mnged Cre MPN This pmphlet contins importnt informtion bout your medicl cre in cse of workrelted injmy or illness You

More information

Outline. CSE 326: Data Structures. Priority Queues Leftist Heaps & Skew Heaps. Announcements. New Heap Operation: Merge

Outline. CSE 326: Data Structures. Priority Queues Leftist Heaps & Skew Heaps. Announcements. New Heap Operation: Merge CSE 26: Dt Structures Priority Queues Leftist Heps & Skew Heps Outline Announcements Leftist Heps & Skew Heps Reding: Weiss, Ch. 6 Hl Perkins Spring 2 Lectures 6 & 4//2 4//2 2 Announcements Written HW

More information

production for Community & Culture Project Reference e 2 design episodes Bogotá: Building a Sustainable City and Affordable Green Housing.

production for Community & Culture Project Reference e 2 design episodes Bogotá: Building a Sustainable City and Affordable Green Housing. Community & Culture Project Reference e 2 design episodes Bogotá: Building Sustinble City nd Affordble Green Housing. 1) Red the bckground essy nd discussion questions for e 2 design episodes Bogotá: Building

More information

3. Argumentation Frameworks

3. Argumentation Frameworks 3. Argumenttion Frmeworks Argumenttion current hot topic in AI. Historiclly more recent thn other pproches discussed here. Bsic ide: to construct cceptble set(s) of beliefs from given KB: 1 construct rguments

More information

Fractal Analysis on the Stock Price of C to C Electronic Commerce Enterprise Ming Chen

Fractal Analysis on the Stock Price of C to C Electronic Commerce Enterprise Ming Chen 6th Interntionl Conference on Electronic, Mechnicl, Informtion nd Mngement (EMIM 2016) Frctl Anlysis on the Stock Price of C to C Electronic Commerce Enterprise Ming Chen Soochow University, Suzhou, Chin

More information

MATH 236 ELAC MATH DEPARTMENT FALL 2017 SHORT ANSWER. Write the word or phrase that best completes each statement or answers the question.

MATH 236 ELAC MATH DEPARTMENT FALL 2017 SHORT ANSWER. Write the word or phrase that best completes each statement or answers the question. MATH 236 ELAC MATH DEPARTMENT FALL 2017 TEST 1 REVIEW SHORT ANSWER. Write the word or phrse tht best completes ech sttement or nswers the question. 1) The supply nd demnd equtions for certin product re

More information

APPENDIX 5 FORMS RELATING TO LISTING FORM F GEM COMPANY INFORMATION SHEET

APPENDIX 5 FORMS RELATING TO LISTING FORM F GEM COMPANY INFORMATION SHEET APPENDIX 5 FORMS RELATING TO LISTING FORM F GEM COMPANY INFORMATION SHEET Cse Number: 20180815-I18008-0004 Hong Kong Exchnges nd Clering Limited nd The Stock Exchnge of Hong Kong Limited tke no responsibility

More information

This article appeared in a journal published by Elsevier. The attached copy is furnished to the author for internal non-commercial research and

This article appeared in a journal published by Elsevier. The attached copy is furnished to the author for internal non-commercial research and This rticle ppered in journl published by Elsevier. The ttched copy is furnished to the uthor for internl non-commercil reserch nd eduction use, including for instruction t the uthors institution nd shring

More information

Information Acquisition and Disclosure: the Case of Differentiated Goods Duopoly

Information Acquisition and Disclosure: the Case of Differentiated Goods Duopoly Informtion Acquisition nd Disclosure: the Cse of Differentited Goods Duopoly Snxi Li Jinye Yn Xundong Yin We thnk Dvid Mrtimort, Thoms Mriotti, Ptrick Rey, Wilfried Snd-Zntmn, Frnces Xu nd Yongsheng Xu

More information

International Budget Partnership OPEN BUDGET QUESTIONNAIRE POLAND

International Budget Partnership OPEN BUDGET QUESTIONNAIRE POLAND Interntionl Budget Prtnership OPEN BUDGET QUESTIONNAIRE POLAND September 28, 2007 Interntionl Budget Prtnership Center on Budget nd Policy Priorities 820 First Street, NE Suite 510 Wshington, DC 20002

More information

Earning Money. Earning Money. Curriculum Ready ACMNA: 189.

Earning Money. Earning Money. Curriculum Ready ACMNA: 189. Erning Money Curriculum Redy ACMNA: 189 www.mthletics.com Erning EARNING Money MONEY Different jos py different mounts of moneys in different wys. A slry isn t pid once in yer. It is pid in equl prts

More information

No. 27 / October Ebert, Michael / Kadane, Joseph B. / Simons, Dirk / Stecher, Jack D. Disclosure and Rollover Risk

No. 27 / October Ebert, Michael / Kadane, Joseph B. / Simons, Dirk / Stecher, Jack D. Disclosure and Rollover Risk No. 27 / October 2017 Ebert, Michel / Kdne, Joseph B. / Simons, Dirk / Stecher, Jck D. Disclosure nd Rollover Risk Disclosure nd Rollover Risk Michel Ebert 1 Joseph B. Kdne 2 Dirk Simons 3 Jck D. Stecher

More information

Access your online resources today at

Access your online resources today at 978--07-670- - CmbridgeMths: NSW Syllbus for the Austrlin Curriculum: Yer 0: Stte./. Access your online resources tody t www.cmbridge.edu.u/go. Log in to your existing Cmbridge GO user ccount or crete

More information

Trigonometry - Activity 21 General Triangle Solution: Given three sides.

Trigonometry - Activity 21 General Triangle Solution: Given three sides. Nme: lss: p 43 Mths Helper Plus Resoure Set. opyright 003 rue. Vughn, Tehers hoie Softwre Trigonometry - tivity 1 Generl Tringle Solution: Given three sides. When the three side lengths '', '' nd '' of

More information

Open Space Allocation and Travel Costs

Open Space Allocation and Travel Costs Open Spce Alloction nd Trvel Costs By Kent Kovcs Deprtment of Agriculturl nd Resource Economics University of Cliforni, Dvis kovcs@priml.ucdvis.edu Pper prepred for presenttion t the Americn Agriculturl

More information

Name Date. Find the LCM of the numbers using the two methods shown above.

Name Date. Find the LCM of the numbers using the two methods shown above. Lest Common Multiple Multiples tht re shred by two or more numbers re clled common multiples. The lest of the common multiples is clled the lest common multiple (LCM). There re severl different wys to

More information

PRICING CONVERTIBLE BONDS WITH KNOWN INTEREST RATE. Jong Heon Kim

PRICING CONVERTIBLE BONDS WITH KNOWN INTEREST RATE. Jong Heon Kim Kngweon-Kyungki Mth. Jour. 14 2006, No. 2, pp. 185 202 PRICING CONVERTIBLE BONDS WITH KNOWN INTEREST RATE Jong Heon Kim Abstrct. In this pper, using the Blck-Scholes nlysis, we will derive the prtil differentil

More information

Today s Outline. One More Operation. Priority Queues. New Operation: Merge. Leftist Heaps. Priority Queues. Admin: Priority Queues

Today s Outline. One More Operation. Priority Queues. New Operation: Merge. Leftist Heaps. Priority Queues. Admin: Priority Queues Tody s Outline Priority Queues CSE Dt Structures & Algorithms Ruth Anderson Spring 4// Admin: HW # due this Thursdy / t :9pm Printouts due Fridy in lecture. Priority Queues Leftist Heps Skew Heps 4// One

More information

Bargaining with Deadlines and Private Information

Bargaining with Deadlines and Private Information Brgining with Dedlines nd Privte Informtion VERY PRELIMINARY AND INCOMPLETE Willim Fuchs Andrzej Skrzypcz April 19, 2011 Abstrct 1 Introduction In this pper we study dynmic brgining with privte informtion

More information

End-of-year tax planning tips for business

End-of-year tax planning tips for business Client Informtion Newsletter - Tx & Super June 2017 End-of-yer tx plnning tips for The generl rule is tht you cn clim deductions for expenses your incurs in its tsk of generting ssessble income. Mny of

More information

A Sharper Ratio: A General Measure for Correctly Ranking Non-Normal Investment Risks

A Sharper Ratio: A General Measure for Correctly Ranking Non-Normal Investment Risks A Shrper Rtio: A Generl Mesure for Correctly Rnking on-orml Investment Risks Kent Smetters Xingtn Zhng This Version: Februry 3, 2014 Abstrct While the Shrpe rtio is still the dominnt mesure for rnking

More information

Optimal firm's policy under lead time- and price-dependent demand: interest of customers rejection policy

Optimal firm's policy under lead time- and price-dependent demand: interest of customers rejection policy Optiml firm's policy under led time- nd price-dependent demnd: interest of customers rejection policy Abduh Syid Albn Université Grenoble Alpes, G-SCOP, F-38000 Grenoble, Frnce bduh-syid.lbn@grenoble-inp.org

More information

Drawing Finite State Machines in L A TEX and TikZ A Tutorial

Drawing Finite State Machines in L A TEX and TikZ A Tutorial Drwing Finite Stte Mchines in L A TEX nd TikZ A Tutoril Styki Sikdr nd Dvid Ching ssikdr@nd.edu Version 3 Jnury 7, 208 Introduction L A TEX (pronounced ly-tek) is n open-source, multipltform document preprtion

More information

FINANCIAL ANALYSIS I. INTRODUCTION AND METHODOLOGY

FINANCIAL ANALYSIS I. INTRODUCTION AND METHODOLOGY Dhk Wter Supply Network Improvement Project (RRP BAN 47254003) FINANCIAL ANALYSIS I. INTRODUCTION AND METHODOLOGY A. Introduction 1. The Asin Development Bnk (ADB) finncil nlysis of the proposed Dhk Wter

More information

Burrows-Wheeler Transform and FM Index

Burrows-Wheeler Transform and FM Index Burrows-Wheeler Trnsform nd M Index Ben ngmed You re free to use these slides. If you do, plese sign the guestbook (www.lngmed-lb.org/teching-mterils), or emil me (ben.lngmed@gmil.com) nd tell me briefly

More information

First version: September 1997 This version: October On the Relevance of Modeling Volatility for Pricing Purposes

First version: September 1997 This version: October On the Relevance of Modeling Volatility for Pricing Purposes First version: September 1997 This version: October 1999 On the Relevnce of Modeling Voltility for Pricing Purposes Abstrct: Mnuel Moreno 3 Deprtment of Economics nd Business Universitt Pompeu Fbr Crrer

More information

Measuring Search Trees

Measuring Search Trees Mesuring Serch Trees Christin Bessiere 1, Bruno Znuttini 2, nd Cèsr Fernández 3 1 LIRMM-CNRS, Montpellier, Frnce 2 GREYC, Cen, Frnce 3 Univ. de Lleid, Lleid, Spin Astrct. The SAT nd CSP communities mke

More information

Central Bank forecasts and disclosure policy: Why it pays to be optimistic

Central Bank forecasts and disclosure policy: Why it pays to be optimistic Europen Journl of Politicl Economy 23 (2007) 30 50 www.elsevier.com/locte/ejpe Centrl Bnk forecsts nd disclosure policy: Why it pys to be optimistic Sylvester Eijffinger,b, Mewel F. Tesfselssie c, CentER

More information

OPEN BUDGET QUESTIONNAIRE SOUTH AFRICA

OPEN BUDGET QUESTIONNAIRE SOUTH AFRICA Interntionl Budget Prtnership OPEN BUDGET QUESTIONNAIRE SOUTH AFRICA September 28, 2007 Interntionl Budget Prtnership Center on Budget nd Policy Priorities 820 First Street, NE Suite 510 Wshington, DC

More information

PSAS: Government transfers what you need to know

PSAS: Government transfers what you need to know PSAS: Government trnsfers wht you need to know Ferury 2018 Overview This summry will provide users with n understnding of the significnt recognition, presenttion nd disclosure requirements of the stndrd.

More information

Business Fees and Charges

Business Fees and Charges Business Fees nd Chrges 21 August 2017 1 COVER IMAGE: Drren Rpid Auto Locl Business Member Goulburn Fee Summry Tble Everydy Trnsction Account Everydy Business (S90) Monthly Service Fee Trnsction Fees rediatm

More information

Pairwise sequence comparison. Global alignment with linear gap cost

Pairwise sequence comparison. Global alignment with linear gap cost Pirwise sequence comprison Globl linment with liner p cost DNA sequences The humn enome 5 cells, ech contins 3 pirs of chromosomes, DNA molecules, which stores enetic informtion... GGCCTAAAGGCGCCGGTCTT

More information

Conditions for FlexiLink

Conditions for FlexiLink Conditions for FlexiLink Your policy 1 Wht your policy covers FlexiLink is single-premium investment-linked pln designed to increse the vlue of your investment. Through this pln, you cn invest in one or

More information

Decision Making Under Uncertainty

Decision Making Under Uncertainty CSC384: Intro to Artificil Intelligence Preferences Decision Mking Under Uncertinty Decision Trees DBN: 15.1 nd 15.5 Decision Network: 16.1,16.2,16.5,16.6 I give root plnning prolem: I wnt coffee ut coffee

More information

The Combinatorial Seller s Bid Double Auction: An Asymptotically Efficient Market Mechanism*

The Combinatorial Seller s Bid Double Auction: An Asymptotically Efficient Market Mechanism* The Combintoril Seller s Bid Double Auction: An Asymptoticlly Efficient Mret Mechnism* Rhul Jin nd Prvin Vriy EECS Deprtment University of Cliforni, Bereley (rjin,vriy)@eecs.bereley.edu We consider the

More information

Characterizing Higher-Order Ross More Risk Aversion by Comparison of Risk Compensation

Characterizing Higher-Order Ross More Risk Aversion by Comparison of Risk Compensation Chrcterizing Higher-Order Ross More Risk Aversion by Comprison of Risk Compenstion Guoqing Tin Yougong Tin b,c Deprtment of Economics, Texs A&M University, College Sttion, TX77843, USA b School of Economics,

More information

Lecture 9: The E/R Model II. 2. E/R Design Considerations 2/7/2018. Multiplicity of E/R Relationships. What you will learn about in this section

Lecture 9: The E/R Model II. 2. E/R Design Considerations 2/7/2018. Multiplicity of E/R Relationships. What you will learn about in this section Leture 9: The E/R Moel II Leture n tivity ontents re se on wht Prof Chris Ré use in his CS 45 in the fll 06 term with permission.. E/R Design Consiertions Wht you will lern out in this setion Multipliity

More information

Edgeworth box. apples. F-f. A-a. trade. f f F. fig leaves

Edgeworth box. apples. F-f. A-a. trade. f f F. fig leaves Chpters 9 nd 1 pples Edgeworth box 9.4.1 F-f trde A- A f f F fig leves pples Edgeworth box 9.4.1 F-f trde A- A Adm gets (f,) Eve gets (F-f, A-) f f F fig leves pples Edgeworth box 9.4.1 F-f endowment A-

More information

checks are tax current income.

checks are tax current income. Humn Short Term Disbility Pln Wht is Disbility Insurnce? An esy explntion is; Disbility Insurnce is protection for your pycheck. Imgine if you were suddenly disbled, unble to work, due to n ccident or

More information

A Static Model for Voting on Social Security

A Static Model for Voting on Social Security A Sttic Model for Voting on Socil Security Henning Bohn Deprtment of Economics University of Cliforni t Snt Brbr Snt Brbr, CA 93106, USA; nd CESifo Phone: 1-805-893-4532; Fx: 1-805-893-8830. E-mil: bohn@econ.ucsb.edu

More information

1. Detailed information about the Appellant s and Respondent s personal information including mobile no. and -id are to be furnished.

1. Detailed information about the Appellant s and Respondent s personal information including mobile no. and  -id are to be furnished. Revised Form 36 nd Form 36A for filing ppel nd cross objection respectively before income tx ppellte tribunl (Notifiction No. 72 dted 23.10.2018) Bckground CBDT issued drft notifiction vide press relese

More information

Chapter55. Algebraic expansion and simplification

Chapter55. Algebraic expansion and simplification Chpter55 Algebric expnsion nd simplifiction Contents: A The distributive lw B The product ( + b)(c + d) C Difference of two squres D Perfect squres expnsion E Further expnsion F The binomil expnsion 88

More information

Effects of Entry Restriction on Free Entry General Competitive Equilibrium. Mitsuo Takase

Effects of Entry Restriction on Free Entry General Competitive Equilibrium. Mitsuo Takase CAES Working Pper Series Effects of Entry Restriction on Free Entry Generl Competitive Euilirium Mitsuo Tkse Fculty of Economics Fukuok University WP-2018-006 Center for Advnced Economic Study Fukuok University

More information

Conditions for GrowthLink

Conditions for GrowthLink Importnt: This is smple of the policy document. To determine the precise terms, conditions nd exclusions of your cover, plese refer to the ctul policy nd ny endorsement issued to you. Conditions for GrowthLink

More information

Problem Set 2 Suggested Solutions

Problem Set 2 Suggested Solutions 4.472 Prolem Set 2 Suggested Solutions Reecc Zrutskie Question : First find the chnge in the cpitl stock, k, tht will occur when the OLG economy moves to the new stedy stte fter the government imposes

More information